Invivogen
Menu

ODN 2006 Biotin

Product Unit size Cat. code Docs. Qty. Price

ODN 2006 Biotin

Class B - Biotin-labeled ODN 2006

Show product

2 x 50 µg

tlrl-2006b
+-
$187
  • About
  • Specifications
  • Contents
  • Details
  • Related products

Biotin labeled Class B CpG oligonucleotide - Human TLR9-preferred ligand

TLR9 activation with ODN 2006
TLR9 activation with ODN 2006

ODN 2006 Biotin is a labeled version of the ODN 2006 (ODN 7909), a Class B CpG oligonucleotide (ODN). ODN 2006 is a short synthetic single-stranded DNA molecule containing unmethylated CpG dinucleotides (CpG motifs). These unmethylated CpG motifs mimic microbial DNA and act as immunostimulants. ODN 2006 is a ligand of choice for human Toll-like receptor 9 (TLR9). 

More details More details

 

Mode of action

Stimulatory CpG ODNs are internalized and activate the endosomal receptor TLR9. Activation of TLR9 triggers NF-κB- and interferon regulatory factor (IRF)-mediated pro-inflammatory responses upon the recognition of unmethylated cytosine-phosphorothioate-guanosine (CpG) forms of DNA [1-3]. Unmethylated CpG dinucleotides are a hallmark of microbial (bacterial, viral, fungal, and parasite) DNA and mitochondrial self-DNA [3, 4]. Class B (Type K) CpG ODNs, such as ODN 2006, contain a full phosphorothioate backbone with one or more CpG dinucleotides. They strongly activate B cells but weakly stimulate IFN-α secretion in plasmacytoid dendritic cells [5]. 

InvivoGen's ODN 2006 Biotin is the labeled version of the ODN 2006, a strong TLR9 agonist verified using our HEK-Blue™ reporter cell lines expressing human or mouse TLR9. ODN 2006 activates the hTLR9-dependent NF-κB and IRF pathways, as assessed using our THP1-Dual™ hTLR9 reporter cell line expressing two reporter genes, for the NF-κB-inducible SEAP and IRF-inducible Lucia luciferase, as well as hTLR9 (see figures here). 

ODN 2006 Biotin can be used to evaluate CpG ODN cellular uptake and localization using a biotin detection system, light microscopy, or flow cytometry (see figure). The labeled ODN retains the biological activity. 

 

Key features of ODN 2006 Biotin

  • Potent activator of human TLR9
  • Biotin-labeled
  • Synthetic ODN with unmethylated CpG motifs
  • Each lot is functionally tested

 

Get more information about CpG ODNs Classes.

 

Read our review Read our review on TLR9 agonists: double-edged sword for immune therapies.

 

 

References

1. Kumagai Y. et al., 2008. TLR9 as a key receptor of the recognition of DNA. Adv. Drug. Deliv. Rev. 60(7):795-804.
2. Heinz L.X. et al., 2021. TASL is the SLC15A4-associated adaptor for IRF5 activation by TLR7-9. Nature. 581(7808):316-322.
3. Kayraklioglu N. et al., 2021. CpG oligonucleotides as vaccine adjuvants. DNA Vaccines: Methods and Protocols. Methods in Molecular Biology. Vol. 2197. p51-77.
4. Kumar V., 2021. The trinity of cGAS, TLR9, and ALRs: guardians of the cellular galaxy against host-derived self-DNA. Front. Immunol. 11:624597.
5. Krieg A.M. et al., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 374(6522):546-9.

Figures

Detection of ODN 2006 Biotin (flow cytometry)
Detection of ODN 2006 Biotin (flow cytometry)

Detection of ODN 2006 Biotin. THP1-Dual™ hTLR9 cells were incubated with ODN 2006 unmodified or labeled with Biotin for 16h - 24h. After, the cells were fixed and permeabilized, following the incubation with an Anti-Biotin-PE secondary antibody. The intracellular staining was analyzed by flow cytometry.

Back to the top

Specifications

Synonyms: ODN 7909, PF_3512676

Specificity: Human TLR9 agonist

Working concentration: 1-5 μM

ODN 2006 sequence: 5’- tcgtcgttttgtcgttttgtcgtt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).

Quality control:

  • ODN 2006 Biotin has been validated by flow cytometry and cellular assays using HEK-Blue™ TLR9 cells.
  • The absence of bacterial contamination (e.g. lipoproteins and endotoxins) has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.
Back to the top

Contents

  • 2 x 50μg (6.12 nmol) lyophilized ODN 2006 labeled with biotin at the 3’ terminus
  • 2 ml sterile endotoxin-free water

room temperature ODN 2006 Biotin is shipped at room temperature

store Stored at -20°C. Upon resuspension, prepare aliquots of ODN 2006 Biotin and store at -20°C.

stable Product is stable 6 months at -20°C when properly stored.

Alert Avoid repeated freeze-thaw cycles.

Back to the top

Details

CpG ODNs

Synthetic oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODNs), such as ODN 1018, have been extensively studied as adjuvants [1]. These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA [2]. CpG ODNs are recognized by the Toll-like receptor 9 (TLR9), which is expressed on human B cells and plasmacytoid dendritic cells (pDCs), thereby inducing Th1-dominated immune responses [3]. Pre-clinical studies, conducted in rodents and non-human primates, as well as human clinical trials, have demonstrated that CpG ODNs can significantly improve vaccine-specific antibody responses [1]. Three types of stimulatory CpG ODNs have been identified, types A, B, and C, which differ in their immune-stimulatory activities [4-5]. 

 

Toll-like receptor 9

The Toll-like Receptor 9 (TLR9) is an endosomal receptor that triggers NF-κB- and interferon regulatory factor (IRF)-mediated pro-inflammatory responses upon the recognition of unmethylated cytosine-phosphorothioate-guanosine (CpG) forms of DNA [6-8]. Unmethylated CpG dinucleotides are a hallmark of microbial (bacterial, viral, fungal, and parasite) DNA, as well as mitochondrial self-DNA [8,9]. These TLR9 agonists can be mimicked by synthetic oligonucleotides containing CpG motifs (CpG ODNs), which have been extensively studied to improve adaptive immune responses in the context of vaccination [6,8].

TLR9 is mainly expressed in subsets of Dendritic Cells and B cells of all mammals. In rodents, but not in humans, TLR9 is also expressed in monocytes and macrophages [8]. The structure of the receptor varies by 24% between human TLR9 (hTLR9) and mouse TLR9 (mTLR9) [8]. They recognize different CpG motifs, the optimal sequences being GTCGTT and GACGTT for hTLR9 and mTLR9, respectively [10].
 

 

References:

1. Steinhagen F. et al., 2011. TLR-based immune adjuvants. Vaccine 29(17):3341-55.
2. Hemmi H. et al., 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740-5.
3. Coffman RL. et al., 2010. Vaccine adjuvants: Putting innate immunity to work. Immunity 33(4):492-503.
4. Krug A. et al., 2001. Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells. Eur J Immunol, 31(7): 2154-63.
5. Marshall JD. et al., 2005. Superior activity of the type C class of ISS in vitro and in vivo across multiple species. DNA Cell Biol. 24(2):63-72.
6. Kumagai Y. et al., 2008. TLR9 as a key receptor of the recognition of DNA. Adv. Drug. Deliv. Rev. 60(7):795-804.
7. Heinz L.X. et al., 2021. TASL is the SLC15A4-associated adaptor for IRF5 activation by TLR7-9. Nature. 581(7808):316-322.
8. Kayraklioglu N. et al., 2021. CpG oligonucleotides as vaccine adjuvants. DNA Vaccines: Methods and Protocols. Methods in Molecular Biology. Vol. 2197. p51-77.
9. Kumar V., 2021. The trinity of cGAS, TLR9, and ALRs: guardians of the cellular galaxy against host-derived self-DNA. Front. Immunol. 11:624597.
10. Bauer S. et al., 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc Natl Acad Sci USA, 98(16):9237-42.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty