ODN 2006 Biotin
ODN 2006 Biotin | Unit size | Cat. code | Docs | Qty | Price |
---|---|---|---|---|---|
Class B - Biotin-labeled ODN 2006 |
2 x 50 µg |
tlrl-2006b |
Biotin labeled CpG oligonucleotide - Human TLR9 ligand
CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs).
These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA.
They have been shown to induce a coordinated set of immune responses based on the activation of immune cells primarily involved in the recognition of these molecules.
ODN 2006 Biotin is a B-class CpG ODN with a preference for human TLR9.
ODN 2006 Biotin can be used to evaluate CpG ODN cellular uptake and localization using a biotin detection system and light microscopy.
Back to the topSpecifications
Synonyms: ODN 7909, PF_3512676
Specificity: Human TLR9 agonist
Working concentration: 1-5 μM
ODN 2006 sequence : 5’- tcgtcgttttgtcgttttgtcgtt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).
Contents
- 2 x 50μg (6.12 nmol) lyophilized ODN 2006 labeled with biotin at the 3’ terminus
- 2 ml sterile endotoxin-free water
ODN 2006 Biotin is shipped at room temperature
Stored at -20°C. Upon resuspension, prepare aliquots of ODN 2006 Biotin and store at -20°C.
Product is stable 6 months at -20°C when properly stored.
Avoid repeated freeze-thaw cycles.