Invivogen
Menu

ODN 2006 Biotin

ODN 2006 Biotin Unit size Cat. code Docs Qty Price
Class B - Biotin-labeled ODN 2006
2 x 50 µg
tlrl-2006b
+-
$151.00

Biotin labeled CpG oligonucleotide - Human TLR9 ligand

CpG   ODNs are synthetic oligonucleotides that contain unmethylated CpG   dinucleotides in particular sequence contexts (CpG motifs).

These CpG   motifs are present at a 20-fold greater frequency in bacterial DNA   compared to mammalian DNA.

They have been shown to induce a coordinated set of immune responses based on the activation of immune cells primarily involved in the recognition of these molecules.

ODN  2006 Biotin is a B-class CpG ODN with a preference for human TLR9.

ODN 2006 Biotin  can  be used to evaluate CpG ODN cellular uptake and localization using a biotin detection system and light microscopy.

Back to the top

Specifications

Synonyms: ODN 7909, PF_3512676

Specificity: Human TLR9 agonist

Working concentration: 1-5 μM

ODN 2006 sequence : 5’- tgctgcttttgtgcttttgtgctt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).

Back to the top

Contents

  • 2 x 50μg (6.12 nmol) lyophilized ODN 2006 labeled with biotin at the 3’ terminus
  • 2 ml sterile endotoxin-free water

room temperature ODN 2006 Biotin is shipped at room temperature

store Stored at -20°C. Upon resuspension, prepare aliquots of ODN 2006 Biotin and store at -20°C.

stable Product is stable 6 months at -20°C when properly stored.

Alert Avoid repeated freeze-thaw cycles.

Back to the top

Customer Service
& Technical Support

CAPTCHA
In order to prevent automated spam submissions, please answer the following question:
16 + 0 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Shopping cart is empty