Invivogen
Menu

Sequencing Primers

Cloning Vectors Sequencing Primers

pCpGfree
5' primer GCAGGAAAAGTGGCACTGTG Forward EF1 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
pCpGfree-basic
5' primer GTACCAGTTTTATTGTTTTTAGTGGTAGTG Forward betaGlo MAR
3' primer CATGGTGGAAGCTACTGTACAC Reverse UTR5'
 pCpGfree-promoter
5' primer GTACCAGTTTTATTGTTTTTAGTGGTAGTG Forward betaGlo MAR
3' primer GCCATGTGCTCTCTGCCCACTGAG Reverse EF1 prom
 pCpGfree-vitro
5' primer GTGCAGTAGTCTCTGTGAACATTCAAGC Forward EF1 prom
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
pCpGrich
5' primer GCAGGAAAAGTGGCACTATG Forward EF1 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
       
pFUSE-CLIg / pFUSE-CHIg
5' primer TGCTTGCTCAACTCTACGTC Forward HTLV 5'UTR
pFUSE-Fc / pINFUSE (human IgG1, IgG2, IgG3, IgG4 and rabbit IgG)
5' primer TGCTTGCTCAACTCTACGTC Forward HTLV 5'UTR
3' primer CTCACGTCCACCACCACGCA Reverse Fc
pFUSE-Fc (mouse IgG1)
5' primer TGCTTGCTCAACTCTACGTC Forward HTLV 5'UTR
3' primer GTGAGCACATCCTTGGGCTT Reverse Fc
pFUSE-Fc / pINFUSE (mouse IgG2a, IgG2b, IgG3)
5' primer TGCTTGCTCAACTCTACGTC Forward HTLV 5'UTR
3' primer GGAAGATGAAGACGGATGGTC Reverse Fc
pFUSE-Fc (rat IgG1)
5' primer TGCTTGCTCAACTCTACGTC Forward HTLV 5'UTR
3' primer TGGGAGATCAAGAGGATGTC Reverse Fc
       
pVAC1
5' primer TGTATAGGATGCAACTGCTG Forward IL2ss
3' primer GAAACAAACAGTTCTGAGACCG Reverse EF1 pAn
pVAC2
5' primer TCTCAAGCTTCAGACAGTG Forward rhEF1 5'UTR
3' primer GAAACAAACAGTTCTGAGACCG Reverse EF1 pAn
       
pVITRO1
5' primer GAGGCTAATTCTCAAGCCTC MCS1 Forward rEF1 5'UTR
3' primer TCTAGACCTGGAAAGACCAG MCS1 Reverse FMDV IRES
5' primer TTTTGAGCGGAGCTAATTCTCGGG MCS2 Forward mEF1 5'UTR
3' primer AAAAAACCTCCCACACCTCC MCS2 Reverse SV40 pAn
pVITRO2
5' primer TTTTGAGCGGAGCTAATTCTCGGG MCS1 Forward mEF1 5'UTR
3' primer TCTAGACCTGGAAAGACCAG MCS1 Reverse FMDV IRES
5' primer TTGCCTCATTCTCAAGCCTCAGAC MCS2 Forward chEF1 5'UTR
3' primer GCATTCTAGTTGTGGTTTGTCC MCS2 Reverse SV40 pAn
       
pVIVO1
5' primer GCGCGGCTGGAGGTGTGAGG MCS1 Forward hGRP94 prom
3' primer GAAACAAACAGTTCTGAGACC MCS1 Reverse EF1 pAn
5' primer CTCCTGTCGCCCTCAGATCG MCS2 Forward hGRP78 prom
3' primer AAAAAACCTCCCACACCTCC MCS2 Reverse SV40 pAn
pVIVO2
5' primer TTTTGAGCGGAGCTAATTCTCGGG MCS1 Forward mEF1 5'UTR
3' primer GAAACAAACAGTTCTGAGACCG MCS1 Reverse EF1 pAn
5' primer TTGCCTCATTCTCAAGCCTCAGAC MCS2 Forward chEF1 5'UTR
3' primer GCATTCTAGTTGTGGTTTGTCC MCS2 Reverse SV40 pAn
       
pMONO
5' primer TTTTGAGCGGAGCTAATTCTCGGG MCS Forward mEF1 5'UTR
3' primer TCTAGACCTGGAAAGACCAG MCS Reverse FMDV IRES

 

Open Reading Frames Vectors Sequencing Primers

pUNO / pUNO1 / pUNO2 / pUNO3 / pSelect
5' primer TGCTTGCTCAACTCTACGTC                     Forward             HTLV 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn

 

Discontinued vectors

pBLAST42 / pBLAST49 / pORF / pORF9
5' primer TGCTTGCTCAACTCTACGTC                      Forward            HTLV 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
pBLAST45 / pORF5
5' primer AGCTTTCTTTCCCCAGATCC Forward eiF4g 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
Back to the top

Customer Service
& Technical Support

Contact us
Shopping cart is empty