
Sequencing Primers

Cloning Vectors Sequencing Primers

3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
pFUSE-Fc / pINFUSE (human IgG1, IgG2, IgG3, IgG4 and rabbit IgG)
pFUSE-Fc (mouse IgG1)
pFUSE-Fc / pINFUSE (mouse IgG2a, IgG2b, IgG3)
pFUSE-Fc (rat IgG1)
5' primer GCGCGGCTGGAGGTGTGAGG MCS1 Forward hGRP94 prom
5' primer CTCCTGTCGCCCTCAGATCG MCS2 Forward hGRP78 prom


Open Reading Frames Vectors Sequencing Primers

pUNO / pUNO1 / pUNO2 / pUNO3 / pSelect
5' primer TGCTTGCTCAACTCTACGTC                     Forward             HTLV 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn


Discontinued vectors

pBLAST42 / pBLAST49 / pORF / pORF9
5' primer TGCTTGCTCAACTCTACGTC                      Forward            HTLV 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
pBLAST45 / pORF5
5' primer AGCTTTCTTTCCCCAGATCC Forward eiF4g 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
Back to the top
Customer Service
& Technical Support
Contact us
Shopping cart is empty