
Sequencing Primers

Cloning Vectors Sequencing Primers

3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
pFUSE-Fc / pINFUSE (human IgG1, IgG2, IgG3, IgG4 and rabbit IgG)
pFUSE-Fc (mouse IgG1)
pFUSE-Fc / pINFUSE (mouse IgG2a, IgG2b, IgG3)
pFUSE-Fc (rat IgG1)
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
Light chain, 5’ primer TTGCCTCATTCTCAAGCCTCAGAC Forward chEF1 5'UTR
Light chain, 3’ primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
Heavy chain, 5’ primer GGGGGAGGGGATGTAATGGCGTTG Forward mEF1 5'UTR
Heavy chain, 3’ primer TTAGGCAGAATCCAGATGCTC Reverse hßGlobin pAn
5' primer GCGCGGCTGGAGGTGTGAGG MCS1 Forward hGRP94 prom
5' primer CTCCTGTCGCCCTCAGATCG MCS2 Forward hGRP78 prom


Open Reading Frames Vectors Sequencing Primers

pUNO / pUNO1 / pUNO2 / pUNO3 / pSelect
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn


Discontinued vectors

pBLAST42 / pBLAST49 / pORF / pORF9
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
pBLAST45 / pORF5
5' primer AGCTTTCTTTCCCCAGATCC Forward eiF4g 5'UTR
3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn
Back to the top
Customer Service
& Technical Support
Contact us
Shopping cart is empty