Invivogen
Menu

ODN 2006 control (ODN 2137)

ODN 2006 control (ODN 2137) Unit size Cat. code Docs Qty Price
Negative control for ODN 2006
1 mg
tlrl-2006c-1
+-
$511.00

Negative control for ODN 2006

ODN 2006 Control (ODN 2137) contains GpC dinucleotides instead of CpGs and can be used as a negative control for ODN 2006 (type B, with a preference for human TLR9).

Back to the top

Specifications

Synonym: ODN 2137

Working concentration: 5 µM (10 μg/ml)

Solubility:  5 mg/ml in water

ODN 2006 Control sequence : 5’- tgctgcttttgtgcttttgtgctt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).

Quality control:

Back to the top

Contents

  • 1 mg (130 nmol) lyophilized ODN 2006 Control (ODN 2137)
  • 1.5 ml sterile endotoxin-free water

 

room temperature ODN 2006 Control (ODN 2137) is shipped at room temperature.

store Upon receipt, store at -20 °C.

Back to the top

Citations

Load more
Customer Service
& Technical Support
Shopping cart is empty