
ODN 2006 control (ODN 2137)

ODN 2006 control (ODN 2137) Unit size Cat. code Docs Qty Price
Negative control for ODN 2006
200 µg
1 mg
5 mg

Negative control for ODN 2006

ODN 2006 Control (ODN 2137) contains GpC dinucleotides instead of CpGs and can be used as a negative control for ODN 2006 (type B, with a preference for human TLR9).

Back to the top


Synonym: ODN 2137

Working concentration: 5 µM (10 μg/ml)

Solubility:  5 mg/ml in water

ODN 2006 Control sequence : 5’- tgctgcttttgtgcttttgtgctt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).

Quality control:

Back to the top


ODN 2006 Control is lyophilized and is available in three quantities.

tlrl-2006c (formerly tlrl-hodnbc):

  • 200 μg (26 nmol) lyophilized ODN 2006 Control
  • 1.5 ml sterile endotoxin-free water

tlrl-2006c-1 (formerly tlrl-hodnbc-1):

  • 1 mg (130 nmol) lyophilized ODN 2006 Control
  • 1.5 ml sterile endotoxin-free water

tlrl-2006c-5 (formerly tlrl-hodnbc-5):

  • 5 mg (650 nmol) lyophilized ODN 2006 Control
  • 10 ml sterile endotoxin-free water

room temperature ODN 2006 Control (ODN 2137) is shipped at room temperature.

store Upon receipt, store at -20 °C.

Back to the top


Load more
Customer Service
& Technical Support
Shopping cart is empty