G3-YSD Control
G3-YSD Control | Unit size | Cat. code | Docs | Qty | Price |
---|---|---|---|---|---|
Control for cGAS Agonist G3-YSD |
200 µg |
tlrl-ydnac |
Negative control for G3-YSD
G3-YSD Control is a negative control for G3-YSD, a potent cGAS (cyclic GMP-AMP synthase, cGAMP synthase) agonist.
This negative control differs from the G3-YSD agonist in the hairpin-flanking nucleoside trimers.
While G3-YSD is flanked with guanosine trimers (G3) conferring its agonist activity, G3-YSD Control is flanked with cytidine trimers (C3) abrogating cGAS activation [1].
Reference:
1. Herzner AM. et al., 2015. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA. Nat Immunol. 16(10):1025-33.
Back to the topSpecifications
Activity: Control for G3-YSD (cGAS agonist)
Working concentration: 100 ng - 1 μg/ml
Sequence: 5’ CCC TATATATATGCATATATATA CCC 3’ (26 mer)
Note: G3-YSD Control contains a palindromic sequence for which self-hybridization results in double-stranded DNA. The flanking cytidine trimers in 5' and 3' remain unpaired.
Molecular weight: 7843.3 g/mol
Quality control:
- The inability to induce type I interferon has been verified using cellular assays.
- The absence of bacterial contamination, such as lipoproteins and endotoxins, has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.
Contents
- 200 μg G3-YSD Control (C3-ended Y-form Short DNA)
- 1.5 ml sterile endotoxin-free water
G3-YSD Control is provided lyophilized and shipped at room temperature.
Store at -20°C.
Upon resuspension, prepare aliquots and store at -20°C.