G3-YSD Control

Negative control for G3-YSD

G3-YSD Control is a negative control for G3-YSD, a potent cGAS (cyclic GMP-AMP synthase, cGAMP synthase) agonist.

This negative control differs from the G3-YSD agonist in the hairpin-flanking nucleoside trimers.

While G3-YSD is flanked with guanosine trimers (G3) conferring its agonist activity, G3-YSD Control is flanked with cytidine trimers (C3) abrogating cGAS activation [1].

 

Reference:

1. Herzner AM. et al., 2015. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA. Nat Immunol. 16(10):1025-33.

Back to the top

Specifications

Activity: Control for G3-YSD (cGAS agonist)

Working concentration: 100 ng - 1 μg/ml

Sequence: 5’ CCC TATATATATGCATATATATA CCC 3’ (26 mer)

Note: G3-YSD Control contains a palindromic sequence for which self-hybridization results in double-stranded DNA. The flanking cytidine trimers in 5' and 3' remain unpaired.

Molecular weight: 7843.3 g/mol

Quality control: 

• The inability to induce type I interferon has been verified using cellular assays.
• The absence of bacterial contamination, such as lipoproteins and endotoxins, has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.

Back to the top

Contents

• 200 μg G3-YSD Control (C3-ended Y-form Short DNA)
• 1.5 ml sterile endotoxin-free water

G3-YSD Control is provided lyophilized and shipped at room temperature.

Store at -20°C.

Upon resuspension, prepare aliquots and store at -20°C.

Back to the top