Invivogen
Menu

Wuhan-Hu-1 Spike (D614G) Expression Vectors

pUNO1-SpikeV1 Unit size Cat. code Docs Qty Price
Wuhan-Hu-1 Spike gene with D614G mutation
20 µg
p1-spike-v1
+-
$409.00
pUNO1-SpikeV1-dfur Unit size Cat. code Docs Qty Price
Wuhan-Hu-1 Spike gene (inactivated furin site) with D614G mutation
20 µg
p1-spike-v1-df
+-
$409.00

Optimized SARS-CoV-2 Spike (G614-variant) gene for mammalian cell expression

pUNO1-SpikeV1 and pUNO1-SpikeV1-dfur plasmids have been specifically designed for the expression of the SARS-CoV-2 Spike (S) protein in mammalian cells. These plasmids encode the full-length Spike sequence from the Wuhan-Hu-1 isolate with the D614G mutation, and for optimal cellular expression, it is codon-optimized and the C‑terminal ER-retention signal has been removed [1, 2].

 

Globally dominant Spike G614-variant Expression vectors
Spike G614-variant expression vectors
for cell fusion and flow cytometry assays

Gene Description

These plasmids encode the Spike protein from the SARS-CoV-2 Wuhan-Hu-1 isolate with the D614G mutation. Since April 2020, this signature mutation has globally replaced the original sequence and is present in all subsequent variants of SARS-CoV-2 from Clade 20/Lineage B (Nextstrain/Pango lineage classification) [3].

  • S1 domain: D614G

Learn more about the emerging SARS-CoV-2 variants around the world

 

The Spike protein contains a furin cleavage site that can affect its cellular expression [4, in-house data]. Therefore, depending on your application InvivoGen offers:

  • pUNO1-SpikeV1: with a functional furin cleavage site and recommended for Spike/ACE2 cell fusion assays
  • pUNO1-SpikeV1-dfur: with an inactive furin (dfur) cleavage site for improved surface expression and detection (flow cytometry)

 More details

 

General Plasmid Description

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal.  The codon-optimized ORF includes the native SARS-CoV-2 Spike signal sequence. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells (transient and stable transfection).

 

Applications

  • Spike-mediated cell fusion assays with pUNO1-SpikeV1
  • Cell surface detection by flow cytometry with pUNO1-SpikeV1-dfur
  • Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma

 

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. Korber B.et al. 2020. Tracking changes in SARS-CoV-2 Spike: evidence that D614G increases infectivity of the COVID‑19 virus. Cell. 182:1-16.
4. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Back to the top

Specifications

pUNO1-SpikeV1

  • Origin: Wuhan-Hu-1 isolate
  • Sequence Reference: NC_045512.2 (with D614G mutation)
  • Codon optimized
  • ORF size: 3765 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

pUNO1-SpikeV1-dfur

  • Origin: Wuhan-Hu-1 isolate
  • Sequence Reference: NC_045512.2 (with D614G mutation)
  • Codon optimized and R683/5A mutations
  • ORF size: 3765 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.
Back to the top

Contents

pUNO1-SpikeV1 and pUNO1-SpikeV1-dfur are provided as follows:

Please note: Each plasmid is sold separately. 

  • 20 μg of lyophilized DNA
  • 2 x 1 ml Blasticidin at 10 mg/ml

 

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

AlertAvoid repeated freeze-thaw cycles.

Back to the top

Details

Furin cleavage site in the SARS-CoV-2 Spike protein

A furin cleavage sequence (RRxR) is found within a polybasic cleavage site (681-PRRSR/SVA-688) at the boundary between the S1 and S2 domains (S1/S2) of the Spike protein [1]. Furin is enriched in the Golgi apparatus, where it functions to cleave proteins into their 'mature/active forms'. Specifically, it is suggested that cleavage at this site by furin pre-primes the SARS-CoV-2 S protein during its production. This allows further processing by cell surface host proteases (e.g. TMPRSS2)  upon binding to ACE2, which ultimately facilitates viral-host membrane fusion [2,3].

► In a mammalian expression system (e.g. HEK293 cells), to maximize the surface expression of the S protein, the furin cleavage site in InvivoGen's pUNO1-SpikeV1-dfur has been inactivated (in-house data). The crucial recognition residues have been mutated (R683A and R685A) ensuring that the S protein is not cleaved by furin. 

Furthermore, the S protein possesses cell-cell fusogenic activity and has been shown to trigger large syncytia formation (multi-nucleated cells). Notably, overexpression of an uncleavable S protein (mutated/inactivated furin cleavage site) has been shown to not induce cell-cell fusion, suggesting that cleavage at the multibasic site is a requirement for syncytia formation [3].

► To study cell-cell fusion by the SARS-CoV-2 spike, InvivoGen offers the pUNO1-SpikeV1 plasmid.

 

References:

1. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.
2. Johnson, B.A. et al. 2021. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature
3. Papa, G. et al. 2021. Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for infection and cell-cell fusion. PLoS Pathog 17, e1009246.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty