Invivogen
Menu

Tagged Nucleocapsid Production Vectors

pUNO1His-SARS2-N Unit size Cat. code Docs Qty Price
His-tagged SARS-CoV-2 Nucleocapsid gene
20 µg
p1his-cov2-n
+-
$448.00
pUNO1Fc-SARS-N Unit size Cat. code Docs Qty Price
Fc-tagged SARS-CoV-2 Nucleocapsid gene
20 µg
p1fc-cov2-n
+-
$448.00

You may also need : Blasticidin | View more associated products

SARS-CoV-2 Nucleocapsid, codon-optimized & tagged in C-term

Schematic of tagged SARS2 nucleocapsid protein production vectors
Schematic of tagged SARS2 nucleocapsid production vectors

GENE DESCRIPTION

The SARS-CoV-2 (2019-nCov) Nucleocapsid (N) is a phosphoprotein that associates with the viral RNA genome and forms the ribonucleoprotein core. This structural protein plays a number of important roles in the viral life cycle including replicationtranscription, and genome packaging. These functions are mediated by two principal domains located at the N- and C-terminal termed  NTD and CTD, respectively [1-6].
pUNO1His-SARS2-N and pUNO1Fc-SARS2-N express a codon-optimized nucleocapsid sequence fused to a C-terminal His- or Fc-tag, respectively.  Both plasmids contain the nucleocapsid coding sequence from the Wuhan-Hu-1 isolate. (See Specifications for more information)

 

PLASMID DESCRIPTION

pUNO1His-SARS2-N and pUNO1Fc-SARS2-N are designed for the production and secretion of a tagged nucleocapsid protein. These vectors feature a potent mammalian expression cassette comprised of the strong SV40 enhancer, the ubiquitous human EF1α-HTLV composite promoter, and the SV40 polyadenylation (pAn) signal. The codon-optimized nucleocapsid coding sequence is preceded by an exogenous signal sequence to ensure effective protein secretion. Both plasmids are selectable with blasticidin in E. coli and mammalian cells.

 

QUALITY CONTROL

  • Fully sequenced ORF
  • Predominant supercoiled conformation

 

The native untagged nucleocapsid gene is available in the pUNO1-SARS2-N expression plasmid.

 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Mu, J. et al. 2020. SARS-CoV-2-encoded nucleocapsid protein acts as a viral suppressor of RNA interference in cells. Sci China Life Sci 63, 1-4.
2. Chang C. et al., 2006. Modular organization of SARS coronavirus nucleocapsid protein. J. Biom. Sci. 13:59-72.
3. Krokhin O. et al., 2003. Mass spectrometric characterization of proteins from the SARS virus. Mol. & Cell. Prot. 2:346-356.
4. Cubuk, J. et al. 2020. The SARS-CoV-2 nucleocapsid protein is dynamic, disordered, and phase separates with RNA. bioRxiv. doi:10.1101/2020.06.17.158121.
5. Kang, S. et al. 2020. Crystal structure of SARS-CoV-2 nucleocapsid protein RNA binding domain reveals potential unique drug targeting sites. Acta Pharm Sin B. doi:10.1016/j.apsb.2020.04.009.
6. Khan, M.T. et al. 2020. SARS-CoV-2 nucleocapsid and Nsp3 binding: an in silico study. Arch Microbiol. doi: 10.1007/s00203-020-01998-6.

 

Back to the top

Specifications

pUNO1His-SARS2-N

  • Strain: Wuhan-Hu-1 isolate
  • ORF (N::His): Codon-optimized 1344 bp
  • Signal sequence: Exogenous (Lucia luciferase)
  • Tag: C-terminal 6xHistidine (6xHis) 
  • Subcloning restriction sites: 5' AgeI or NcoI and 3' NheI
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI
    - NcoI generates cohesive ends compatible with BspHI, FatI, and PciI
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT

pUNO1Fc-SARS2-N

  • Strain: Wuhan-Hu-1 isolate
  • ORF (N::hIgG1-Fc): Codon-optimized 2061 bp
  • Signal sequence: Exogenous (Lucia luciferase)
  • Tag: C-terminal human IgG1-Fc 
  • Subcloning restriction sites: Due to the lack of a unique restriction site at the 3’ end of the fusion gene, this plasmid does not facilitate the subcloning of the Fc-tagged nucleocapsid gene.
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Back to the top

Contents

pUNO1His-SARS2-N and pUNO1Fc-SARS2-N contain:

  • 20 μg of lyophilized DNA
  • 2 x 1 ml Blasticidin at 10 mg/ml

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 ̊C.

stability Resuspended DNA should be stored at -20 ̊C and is stable up to 1 year.

Alert Blasticidin is a harmful compound. Please refer to the MSDS for handling instructions. Blasticidin can be stored at 4°C or -20°C for up to 2 years. The product is stable for 2 weeks at 37°C.

Alert Avoid repeated freeze-thaw cycles.

Back to the top

Details

Learn more about the SARS-CoV-2 Nucleocapsid protein.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty