Invivogen
Menu

Nucleocapsid (N) Expression Vector

pUNO1-SARS2-N Unit size Cat. code Docs Qty Price
SARS-CoV-2 N gene
20 µg
puno1-cov2-n
+-
$397.00

SARS-CoV-2 Nucleocapsid coding sequence

GENE DESCRIPTION

Nucleocapsid (N) is a phosphoprotein that associates with the viral RNA genome and forms the ribonucleoprotein core [1]. N features two RNA-binding domains in N-terminal and C-terminal. Each domain supports distinct functions, including RNA chaperoning, incorporation, and packing as a helical "beads-on-a-string" conformation [1, 2]. 
pUNO1-SARS2-N contains the wild-type coding sequence of SARS-CoV-2 Nucleocapsid. (See Details and Specifications for more information).

 

Schematic of SARS-CoV-2 nucleocapsid expression vector
Schematic of SARS-CoV-2 nucleocapsid expression vector

PLASMID DESCRIPTION

pUNO1-SARS2-N features a potent mammalian expression cassette comprised of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal. The ORF is flanked by unique restriction sites (AgeI and NheI) to facilitate its subcloning. The plasmid is selectable with blasticidin in both E. coli and mammalian cells. It can be used for transient or stable transfection. It contains no tag.

 

QUALITY CONTROL

  • Fully sequenced ORF
  • Predominant supercoiled conformation

 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Chang C et al., 2006. Modular organization of SARS coronavirus nucleocapsid protein. J. Biom. Sci. 13:59-72.
2. Neuman B.W. & Buchmeier M.J., 2016. Supramolecular architecture of the coronavirus particle. Advances in virus research. 96:1-27.

Figures

SARS-CoV-2 structural proteins
SARS-CoV-2 structural proteins
Schematic of pUNO1-SARS2-N expression vector
Schematic of pUNO1-SARS2-N expression vector
Back to the top

Specifications

  • Strain: Wuhan-Hu-1 isolate
  • Genbank: NC_045512.2
  • ORF size from ATG to Stop codon: 1260 bp
  • Native (wild-type) sequence
  • Subcloning restriction sites in pUNO1: AgeI (in 5’) and NheI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Back to the top

Contents

  • 20 μg of lyophilized DNA
  • 2 x 1 ml blasticidin at 10 mg/ml

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 ̊C.

stability Resuspended DNA should be stored at -20 ̊C and is stable up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions.

Store blasticidin at 4°C or -20°C for up to two years. The product is stable for 2 weeks at 37°C.

Avoid repeated freeze-thaw cycles.

Back to the top

Details

Most of our current knowledge about SARS-CoV-2 N protein comes from previous studies on SARS-CoV. The N proteins from these two β-coronaviruses exhibit a 94% homology in amino acid (a.a) sequences [1].

While the three other structural proteins of the virus, Spike (S), Membrane/Matrix (M), and Envelope (E), are at the interface of the virus to the external environment, N is located inside the viral particle.

Nucleocapsid (N) is a 422 a.a phosphoprotein that associates with the viral RNA genome. N features two RNA-binding domains in N-terminal (NTD) and C-terminal (CTD) [2, 3]. In infected cells, N proteins are associated with sites of viral RNA replication, supporting a chaperone function. In addition, both NTD and CTD support distinct functions:

- the CTD allows the genome incorporation into the new virion and oligomerization of N proteins
- the NTD interacts with the M protein endodomain to form virion particles. In the mature viral particle, the NTD binds the RNA genome, which is packed as a helical "beads-on-a-string" conformation.

It has been suggested that the N protein is a major immunogen of SARS-CoV-2 and as a result could be useful for early diagnosis by ELISA [4].

SARS-CoV-2 N could be among the protein candidates regarding prophylactic vaccination strategies. Although subunit vaccines based on the N protein of the previous SARS-CoV have shown immunogenicity in pre-clinical models, they have not been investigated for their protective effect [5].

Interestingly, both SARS-CoV and SARS-CoV-2 N proteins have been shown to display a viral suppressor of RNAi in mammalian cells, thereby representing a key immune evasion factor [1, 6].

 

References

1. Mu J. et al., 2020. SARS-CoV-2-encoded nucleocapsid protein acts as a viral suppressor of RNA interference in cells. Sci. China Life Sci. DOI: 10.1007/s11427-020-1692-1.
2. Chang C. et al., 2006. Modular organization of SARS coronavirus nucleocapsid protein. J. Biom. Sci. 13:59-72.
3. Krokhin O. et al., 2003. Mass spectrometric characterization of proteins from the SARS virus. Mol. & Cell. Prot. 2:346-356.
4. Liu W. et al., 2020. Evaluation of nucleocapsid and spike protein-based ELISAs for detecting antibodies against SARS-CoV-2. J. Clin. Microbiol. DOI: 10.1128/JCM.00461-20.
5. Wang N. et al., 2020. Subunit vaccines against emerging pathogenic human coronaviruses. Front. Microbiol. 11(298). DOI: 10.3389/fmicb.2020.00298.
6. Cui L.et al., 2015. The nucleocapsid protein of coronaviruses acts as a viral suppressor of RNA silencing in mammalian cells. J. Virol. 89(17):9029-9043.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty