Beta Variant (B.1.351) Spike Expression Vectors

Beta (B.1.351) Spike Expression vectors

Optimized SARS-CoV-2 Spike gene (B.1.351 - South African origin) for mammalian cell expression

pUNO1-SpikeV3 and pUNO1-SpikeV3-dfur plasmids have been specifically designed for the expression of the SARS-CoV-2 Spike (S) protein in mammalian cells with either a functional or inactivated furin (dfur) cleavage site. These plasmids encode the full-length Spike sequence from the Beta variant (B.1.351), and for optimal cellular expression, it is codon-optimized and the C‑terminal ER-retention signal has been removed [1, 2].

 

South African Variant (B.1.351 lineage) Spike Expression vectors
Beta Variant (B.1.351 lineage) Spike Expression vectors
for cell fusion and flow cytometry assays

Gene Description

These plasmids encode the Spike protein from the SARS-CoV-2 Beta variant (B.1.351), first reported in South Africa in October 2020. This variant is classified as a member of Clade 20H/501Y.V2  and B.1.351 v2 lineage (Nextstrain/Pango lineage classification) [3]. It is characterized by the presence of a number of deletions and mutations within the Spike coding region, of which, several are of concern [3,4]. 

  • S1 domain: L18F, D80A, D215G, deletion L242-L244, D614G
  • RBD: K417N, E484K, N501Y
  • S2 domain: A701V

More detailsLearn more about SARS-CoV-2 Variants

 

The Spike protein contains a furin cleavage site that affects its cellular expression [5, in-house data]. Therefore, depending on your application InvivoGen offers:

  • pUNO1-SpikeV3: with a functional furin cleavage site allowing Spike/ACE2 cell fusion assays
  • pUNO1-SpikeV3-dfur: with an inactive furin (dfur) cleavage site allowing improved surface expression for flow cytometry detection

More details More details

 

General Plasmid Description

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal.  The codon-optimized ORF includes the native SARS-CoV-2 Spike signal sequence. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells (transient and stable transfection).

 

Applications

  • Spike-mediated cell fusion assays with pUNO1-SpikeV3
  • Cell surface detection by flow cytometry with pUNO1-SpikeV3-dfur
  • Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma

 

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. Garcia-Beltran, W.F. et al. 2021. Multiple SARS-CoV-2 variants escape neutralization by vaccine-induced humoral immunity. Cell. doi:10.1016/j.cell.2021.03.013
4. Tegally, H. et al. 2020. Emergence and rapid spread of a new severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) lineage with multiple spike mutations in South Africa. Medrxiv. doi:10.1101/2020.12.21.20248640v1
5. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Specifications

pUNO1-SpikeV3

  • Origin: Beta Variant (B.1.351 lineage) | South African origin
  • Sequence Reference: GISAID EPI_ISL_745146
  • Codon Optimized
  • ORF size: 3756 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

pUNO1-SpikeV3-dfur

  • Origin: Beta Variant (B.1.351 lineage) | South African origin
  • Sequence Reference: GISAID EPI_ISL_745146
  • Codon Optimized and R683/5A mutations
  • ORF size: 3756 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

Contents

pUNO1-SpikeV3 and pUNO1-SpikeV3-dfur are provided as follows:

Please note: Each plasmid is sold separately. 

  • 20 μg of lyophilized DNA
  • 2 x 1 ml Blasticidin at 10 mg/ml

 

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

AlertAvoid repeated freeze-thaw cycles.

Details

Furin cleavage site in the SARS-CoV-2 Spike protein

A furin cleavage sequence (RRxR) is found within a polybasic cleavage site (681-PRRSR/SVA-688) at the boundary between the S1 and S2 domains (S1/S2) of the Spike protein [1]. Furin is enriched in the Golgi apparatus, where it functions to cleave proteins into their 'mature/active forms'. Specifically, it is suggested that cleavage at this site by furin pre-primes the SARS-CoV-2 S protein during its production. This allows further processing by cell surface host proteases (e.g. TMPRSS2)  upon binding to ACE2, which ultimately facilitates viral-host membrane fusion [2,3].

► In a mammalian expression system (e.g. HEK293 cells), to maximize the surface expression of the S protein, the furin cleavage site in InvivoGen's pUNO1-SpikeV3-dfur has been inactivated (in-house data). The crucial recognition residues have been mutated (R683A and R685A) ensuring that the S protein is not cleaved by furin. 

Furthermore, the S protein possesses cell-cell fusogenic activity and has been shown to trigger large syncytia formation (multi-nucleated cells). Notably, overexpression of an uncleavable S protein (mutated/inactivated furin cleavage site) has been shown to not induce cell-cell fusion, suggesting that cleavage at the multibasic site is a requirement for syncytia formation [3].

► To study cell-cell fusion by the SARS-CoV-2 spike, InvivoGen offers the pUNO1-SpikeV3 plasmid. 

 

References:

1. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.
2. Johnson, B.A. et al. 2021. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature
3. Papa, G. et al. 2021. Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for infection and cell-cell fusion. PLoS Pathog 17, e1009246.

DOCUMENTS

Documents

pUNO1-SpikeV3

Technical Data Sheet

Plasmid Sequence

Safety Data Sheet

Certificate of analysis

Need a CoA ?

CUSTOMER SERVICE & TECHNICAL SUPPORT

Question about this product ?