Invivogen
Menu

Iota Variant (B.1.526) Spike Expression Vectors

pUNO1-SpikeV6 Unit size Cat. code Docs Qty Price
Spike gene from the Iota Variant (B.1.526)
20 µg
p1-spike-v6
+-
$409.00
pUNO1-SpikeV6-dfur Unit size Cat. code Docs Qty Price
Spike gene (inactivated furin site) from the Iota Variant (B.1.526)
20 µg
p1-spike-v6-df
+-
$409.00

You may also need : SARS-CoV-2 Spike "donor" cells for cell fusion assays | View more associated products

Optimized SARS-CoV-2 Spike gene (B.1.526 - New York origin) for mammalian cell expression

pUNO1-SpikeV6 and pUNO1-SpikeV6-dfur plasmids have been specifically designed for the expression of the SARS-CoV-2 Spike (S) protein in mammalian cells with either a functional or inactivated furin (dfur) cleavage site. These plasmids encode the full-length Spike sequence from the Iota variant (B.1.526), and for optimal cellular expression, it is codon-optimized and the C‑terminal ER-retention signal has been removed [1, 2].

 

New York Variant (B.1.526 lineage) Spike Expression vectors
Iota Variant (B.1.526 lineage) Spike Expression vectors
for cell fusion and flow cytometry assays

Gene Description

These plasmids encode the Spike protein from the SARS-CoV-2 Iota variant (B.1.526), first reported in New York USA, in November 2020. This variant is classified as a member of Clade 21F / B.1.526 lineage (Nextstrain/Pango lineage classification). It is characterized by the presence of a number of mutations within the Spike coding region, of which, several are of concern [3].

  • S1 domain: L5F, T95I, D253G, D614G
  • RBD: E484K
  • S2 domain: A701V

Learn more

 

The Spike protein contains a furin cleavage site that affects its cellular expression [4, in-house data]. Therefore, depending on your application InvivoGen offers:

  • pUNO1-SpikeV6: with a functional furin cleavage site and recommended for Spike/ACE2 cell fusion assays
  • pUNO1-SpikeV6-dfur: with an inactive furin (dfur) cleavage site for improved surface expression and detection (flow cytometry)

 More details

 

General Plasmid Description

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal.  The codon-optimized ORF includes the native SARS-CoV-2 Spike signal sequence. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells (transient and stable transfection).

 

Applications

  • Spike-mediated cell fusion assays with pUNO1-SpikeV6
  • Cell surface detection by flow cytometry with pUNO1-SpikeV6-dfur
  • Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma

 

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. Annavajhala, M.K. et al. 2021. A Novel and Expanding SARS-CoV-2 Variant, B.1.526, Identified in New York. medRxiv doi: 10.1101/2021.02.23.21252259.
4. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Back to the top

Specifications

pUNO1-SpikeV6

  • Origin: Iota Variant (B.1.526 lineage) | New York origin
  • Sequence Reference:  EPI_ISL_765495
  • Codon Optimized
  • ORF size: 3765 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

pUNO1-SpikeV6-dfur

  • Origin: Iota Variant (B.1.526 lineage) | New York origin
  • Sequence Reference:  EPI_ISL_765495
  • Codon Optimized and R683/5A mutations
  • ORF size: 3765 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.
Back to the top

Contents

pUNO1-SpikeV6 and pUNO1-SpikeV6-dfur are provided as follows:

Please note: Each plasmid is sold separately. 

  • 20 μg of lyophilized DNA
  • 2 x 1 ml Blasticidin at 10 mg/ml

 

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

AlertAvoid repeated freeze-thaw cycles.

Back to the top

Details

Furin cleavage site in the SARS-CoV-2 Spike protein

A furin cleavage sequence (RRxR) is found within a polybasic cleavage site (681-PRRSR/SVA-688) at the boundary between the S1 and S2 domains (S1/S2) of the Spike protein [1]. Furin is enriched in the Golgi apparatus, where it functions to cleave proteins into their 'mature/active forms'. Specifically, it is suggested that cleavage at this site by furin pre-primes the SARS-CoV-2 S protein during its production. This allows further processing by cell surface host proteases (e.g. TMPRSS2)  upon binding to ACE2, which ultimately facilitates viral-host membrane fusion [2,3].

► In a mammalian expression system (e.g. HEK293 cells), to maximize the surface expression of the S protein, the furin cleavage site in InvivoGen's pUNO1-SpikeV6-dfur has been inactivated (in-house data). The crucial recognition residues have been mutated (R683A and R685A) ensuring that the S protein is not cleaved by furin. 

Furthermore, the S protein possesses cell-cell fusogenic activity and has been shown to trigger large syncytia formation (multi-nucleated cells). Notably, overexpression of an uncleavable S protein (mutated/inactivated furin cleavage site) has been shown to not induce cell-cell fusion, suggesting that cleavage at the multibasic site is a requirement for syncytia formation [3].

► To study cell-cell fusion by the SARS-CoV-2 spike, InvivoGen offers the pUNO1-SpikeV6 plasmid. 

 

References:

1. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.
2. Johnson, B.A. et al. 2021. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature
3. Papa, G. et al. 2021. Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for infection and cell-cell fusion. PLoS Pathog 17, e1009246.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty