Invivogen
Menu

Mouse TLR9 Agonist Kit

Mouse TLR9 Agonist Kit Unit size Cat. code Docs Qty Price
Set of known agonists for mouse TLR9
1 kit
tlrl-kit9m
+-
$405.00

Set of known agonists for mouse TLR9

This kit contains archetypal CpG ODNs of the A-, B- or C-class described for mice cells immunostimulation via TLR9.

Choose the most suitable class of ODN for your studies, from:

Back to the top

Specifications

Specificity: Murine TLR9 agonists.

Quality control:

Sequences:
ODN 1585 (class a): 5’- ggGGTCAACGTTGAgggggg -3’ (20 mer).
ODN 1585 Control: 5’- ggGGTCAAGCTTGAgggggg-3'' (20 mer).

ODN 1826 (class B): 5’- tccatgacgttcctgacgtt-3’ (20 mer).
ODN 1826 Control: 5’- tccatgagcttcctgagctt -3’ (20 mer).

ODN2395 (class C): 5’- tcgtcgttttcggcgc:gcgccg-3’.
ODN 2395 Control: 5’- tgctgcttttggggggcccccc -3’.

Note: Bases shown in capital letters are phosphodiester, those in lower case are phosphorothioate (nuclease resistant) and palindrome is underlined.

Back to the top

Contents

ODNs are provided lyophilized:

  • 100 μg (15.51 nmol) ODN 1585.
  • 100 μg (15.51 nmol) ODN 1585 Control.
  • 100 μg (15.71 nmol) ODN 1826.
  • 100 μg (15.71 nmol) ODN 1826 Control (ODN 2138).
  • 100 μg (14.18 nmol) ODN 2395.
  • 100 μg (14.18 nmol) ODN 2395 Control.
  • 1.5 ml endotoxin-free water.

Products are shipped at room temperature

Products should be stored at -20°C.

Back to the top

Description

CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs).

These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA [1, 2].

CpG ODNs are recognized by Toll-like receptor 9 (TLR9) leading to strong immunostimulatory effects.

 

• ODN 1585 is a class A CpG ODN with a preference towards mouse TLR9. Class A CpG ODNs are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string.
They induce high IFN-a production from plasmacytoid dendritic cells (pDC) but are weak stimulators of TLR9-dependent NF-kB signaling.

 

• ODN 1585 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1585.

 

• ODN 1826 is a class B CpG ODN with a preference towards mouse TLR9. Class B CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. They strongly activate B cells but weakly stimulate IFN-α secretion.

 

• ODN 1826 Control (also known as ODN 2138) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1826.

 

• ODN 2395 is a class C CpG ODN for human and mouse TLR9. Class C CpG ODNs combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif. Class C CpG ODNs induce strong IFN-α production from pDC and B cell stimulation.

 

• ODN 2395 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control with ODN 2395.

 

1. Krieg am. et al., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature, 374(6522):546-9.
2. Bauer, S. et al., 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98(16):9237-42.

Back to the top

Customer Service
& Technical Support

CAPTCHA
In order to prevent automated spam submissions, please answer the following question:
7 + 5 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Shopping cart is empty