Invivogen
Menu

Mouse TLR9 Agonist Kit

Product Unit size Cat. code Docs. Qty. Price

Mouse TLR9 Agonist Kit

Set of known agonists for mouse TLR9

Show product

1 kit

tlrl-kit9m
+-
$547

CpG-ODN Classes
CpG-ODN Classes

Set of known agonists for mouse TLR9

This kit contains archetypal CpG ODNs of the A-, B- or C-class described for mice cells immunostimulation via TLR9.

Choose the most suitable class of ODN for your studies, from:

 

 More details

 

Read our review about TLR9 agonists.

 

Back to the top

Specifications

Specificity: Murine TLR9 agonists

Quality control:

Sequences:
ODN 1585 (class A): 5’- ggGGTCAACGTTGAgggggg -3’ (20 mer)
ODN 1585 Control: 5’- ggGGTCAAGCTTGAgggggg-3'' (20 mer)

ODN 1826 (class B): 5’- tccatgacgttcctgacgtt-3’ (20 mer)
ODN 1826 Control: 5’- tccatgagcttcctgagctt -3’ (20 mer)

ODN2395 (class C): 5’- tcgtcgttttcggcgc:gcgccg-3’ (22 mer)
ODN 2395 Control: 5’- tgctgcttttggggggcccccc -3’ (22 mer)

Note: Bases shown in capital letters are phosphodiester, those in lower case are phosphorothioate (nuclease resistant) and palindrome is underlined.

Back to the top

Contents

ODNs are provided lyophilized:

  • 100 μg (15.51 nmol) ODN 1585
  • 100 μg (15.51 nmol) ODN 1585 Control
  • 100 μg (15.71 nmol) ODN 1826
  • 100 μg (15.71 nmol) ODN 1826 Control (ODN 2138)
  • 100 μg (14.18 nmol) ODN 2395
  • 100 μg (14.18 nmol) ODN 2395 Control
  • 1.5 ml endotoxin-free water

Products are shipped at room temperature.

Products should be stored at -20°C.

Back to the top

Details

CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs). These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA [1, 2]. CpG ODNs are recognized by Toll-like receptor 9 (TLR9) leading to strong immunostimulatory effects.

ODN 1585 is a class A CpG ODN with a preference towards mouse TLR9. Class A CpG ODNs are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string. They induce high interferon-α (IFN-α) production from plasmacytoid dendritic cells (pDC) but are weak stimulators of TLR9-dependent NF-κB signaling.

ODN 1585 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1585.

ODN 1826 is a class B CpG ODN with a preference towards mouse TLR9. Class B CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. They strongly activate B cells but weakly stimulate IFN-α secretion.

ODN 1826 Control (also known as ODN 2138) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1826.

ODN 2395 is a class C CpG ODN for human and mouse TLR9. Class C CpG ODNs combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif. Class C CpG ODNs induce strong IFN-α production from pDC and B cell stimulation.

ODN 2395 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control with ODN 2395.

 

1. Krieg A.M. et al., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature, 374(6522):546-9.
2. Bauer S. et al., 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98(16):9237-42.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty