Mouse TLR9 Agonist Kit

Set of known agonists for mouse TLR9

ABOUT

Set of known agonists for mouse TLR9

This kit contains archetypal CpG ODNs of the A-, B- or C-class described for mice cells immunostimulation via TLR9.

Choose the most suitable class of ODN for your studies, from:

 

More details

 

Read our review about TLR9 agonists.

All products are for research use only, and not for human or veterinary use.

SPECIFICATIONS

Specifications

Source
Synthetic
Target species

Mouse

Sequence

ODN 1585 (class a): 5’- ggGGTCAACGTTGAgggggg -3’ (20 mer) 

ODN 1585 Control: 5’- ggGGTCAAGCTTGAgggggg-3'' (20 mer) 

ODN 1826 (class B): 5’- tccatgacgttcctgacgtt-3’ (20 mer) 

ODN 1826 Control: 5’- tccatgagcttcctgagctt -3’ (20 mer) 

ODN 2395 (class C): 5’- tcgtcgttttcggcgc:gcgccg-3’ 

ODN 2395 Control: 5’- tgctgcttttggggggcccccc -3’

Tested applications

PRR cellular assays

Quality control

Each lot has been functionally tested and validated

CONTENTS

Contents

  • Product: 
    Mouse TLR9 Agonist Kit
  • Cat code: 
    tlrl-kit9m
  • Quantity: 
    1 kit
Includes:
  • 100 μg (15.51 nmol) ODN 1585
  • 100 μg (15.51 nmol) ODN 1585 Control
  • 100 μg (15.71 nmol) ODN 1826
  • 100 μg (15.71 nmol) ODN 1826 Control (ODN 2138)
  • 100 μg (14.18 nmol) ODN 2395
  • 100 μg (14.18 nmol) ODN 2395 Control
  • 1.5 ml endotoxin-free water

Shipping & Storage

  • Shipping method:  Room temperature
  • Storage:

    • Upon receipt store at -20°C.

    Caution:

    • Avoid repeated freeze-thaw cycles

Details

CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs). These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA [1, 2]. CpG ODNs are recognized by Toll-like receptor 9 (TLR9) leading to strong immunostimulatory effects.

ODN 1585 is a class A CpG ODN with a preference towards mouse TLR9. Class A CpG ODNs are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string. They induce high interferon-α (IFN-α) production from plasmacytoid dendritic cells (pDC) but are weak stimulators of TLR9-dependent NF-κB signaling.

ODN 1585 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1585.

ODN 1826 is a class B CpG ODN with a preference towards mouse TLR9. Class B CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. They strongly activate B cells but weakly stimulate IFN-α secretion.

ODN 1826 Control (also known as ODN 2138) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1826.

ODN 2395 is a class C CpG ODN for human and mouse TLR9. Class C CpG ODNs combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif. Class C CpG ODNs induce strong IFN-α production from pDC and B cell stimulation.

ODN 2395 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control with ODN 2395.

 

1. Krieg A.M. et al., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature, 374(6522):546-9.
2. Bauer S. et al., 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98(16):9237-42.

DOCUMENTS

Documents

Mouse TLR9 Agonist Kit

Technical Data Sheet

Safety Data Sheet

Certificate of analysis

Need a CoA ?

CUSTOMER SERVICE & TECHNICAL SUPPORT

Question about this product ?