ODN 2006 Biotin

Biotin labeled CpG oligonucleotide - Human TLR9 ligand

CpG   ODNs are synthetic oligonucleotides that contain unmethylated CpG   dinucleotides in particular sequence contexts (CpG motifs). These CpG   motifs are present at a 20-fold greater frequency in bacterial DNA   compared to mammalian DNA. They have been shown to induce a coordinated   set of immune responses based on the activation of immune cells   primarily involved in the recognition of these molecules.

ODN  2006 Biotin is a B-class CpG ODN with a preference for human TLR9. ODN 2006 Biotin  can  be used to evaluate CpG ODN cellular uptake and localization using a biotin detection system and light microscopy.

Contents update notification

February, 3rd 2017
ODN 2006 Biotin is provided as a 100 µg (2 x 50 µg) unit size (previously sold as a 50-µg unit size). This product is now sold at a more competitive price.


Synonyms: ODN 7909, PF_3512676

Specificity: Human TLR9 agonist

Working concentration: 1-5 μM

ODN 2006 sequence
5’- tgctgcttttgtgcttttgtgctt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).


• 2 x 50μg (6.12 nmol) lyophilized ODN 2006 labeled with biotin at the 3’ terminus
• 2 ml sterile endotoxin-free water

ODN 2006 Biotin is shipped at room temperature and should be stored at -20°C.  Upon resuspension, prepare aliquots of ODN 2006 Biotin and store at -20°C. Product is stable 6 months at -20°C when properly stored. Avoid repeated freeze-thaw cycles.


ODN 2006 Biotin

Description Class B - Biotin-labeled ODN 2006
Cat. Codetlrl-2006b
Unit Size2 x 50 µg
Price For price or distributor address,
please select your country
Disclaimer: Our products are provided for research purpose only. Commercial applications may require licensing from third parties.
Note that the sequence of available ORFs provided by InvivoGen can differ from a given reference Genbank record due to genetic variations and/or alternative splicing. Customers should verify that the version of a gene sold by InvivoGen is suitable for the customer needs.
Copyrights © 2011-2016 InvivoGen. All Rights Reserved. Reproduction of any materials from this site is strictly forbidden without permission for commercial use. Nonprofit use for non-commercial research and educational purposes is permitted, citation should include the URL "www.invivogen.com".