Invivogen
Menu

Tagged Spike RBD Production Vectors

pUNO1His-SARS2-RBD Unit size Cat. code Docs Qty Price
His-tagged SARS-CoV-2 RBD gene
20 µg
p1his-cov2-rbd
+-
$433.00
pUNO1Fc-SARS2-RBD Unit size Cat. code Docs Qty Price
Fc-tagged SARS-CoV-2 RBD gene
20 µg
p1fc-cov2-rbd
+-
$433.00

SARS-CoV-2 Spike RBD, codon-optimized & tagged in C-term

Schematic of tagged SARS2 Spike RBD production vectors
Schematic of tagged SARS2 Spike RBD production vectors

GENE DESCRIPTION

The SARS-CoV-2 (2019-nCoV) Spike RBD (receptor binding domain) has been identified as the key viral element allowing the virus docking to the target cells. RDB is recognized by the ACE2 surface membrane receptor [1-3]. RBD is a candidate for subunit prophylactic vaccines against SARS-CoVs [4, 5]. RBD is also at the center of therapeutic approaches, such as the development and testing of small peptide inhibitors or soluble ACE2 to block the SARS-CoV-2 entry into target cells [6].
pUNO1His-SARS2-RBD and pUNO1Fc-SARS2-RBD express a codon-optimized Spike RBD fused in C-terminus to the His- or Fc-tag, respectively. The coding sequence is preceded by an exogenous signal sequence to ensure effective protein secretion. (See Details and Specifications for more information)

 

PLASMIDS DESCRIPTION

pUNO1His-SARS2-RBD and pUNO1Fc-SARS2-RBD are designed for the production in mammalian cells of the Spike RBD. These vectors feature a potent mammalian expression cassette comprised of the strong SV40 enhancer, the ubiquitous human EF1α-HTLV composite promoter, and the SV40 polyadenylation (pAn) signal. The coding sequence is flanked by unique restriction sites, AgeI and NcoI at the 5' end, NheI at the 3' end of His-tag, and MscI at the 3' end of Fc-tag. Both plasmids are selectable with blasticidin in E. coli and mammalian cells.

 

QUALITY CONTROL

  • Fully sequenced ORFs
  • Predominant supercoiled conformation

 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Li F., 2016. Structure, function, and evolution of coronavirus spike proteins. Annu. Rev. Virol. 3:237-261.
2. Li F. et al., 2005. Structure of SARS coronavirus spike receptor-binding domain complexed with receptor. Science. 309:1864-1868.
3. Walls A.C. et al., 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.
4. Wang N. et al., 2020. Subunit vaccines against emerging pathogenic human coronaviruses. Front. Microbiol. 11:298. DOI: 10.3389/fmicb.2020.00298.
5. Padron-Regalado E., 2020. Vaccines for SARS-CoV-2: Lessons from other coronavirus strains. Infect. Dis. Ther. DOI: 10.1007/s40121-020-00300-x.
6. Monteil V.et al., 2020. Inhibition of SARS-CoV-2 infections in engineered human tissues using clinical-grade soluble human ACE2. Cell. 181:1-9.

Figures

SARS-CoV-2 Spike protein - RBD
SARS-CoV-2 Spike protein - RBD
Schematic of pUNO1His-SARS2-RBD His-tagged production vector
Schematic of pUNO1His-SARS2-RBD His-tagged production vector
Schematic of pUNO1Fc-SARS2-RBD Fc-tagged production vector
Schematic of pUNO1Fc-SARS2-RBD Fc-tagged production vector
Back to the top

Specifications

pUNO1His-SARS2-RBD

  • Strain: Wuhan-Hu-1 isolate
  • ORF size (RBD::His): 756 bp
  • Signal sequence: exogenous (Lucia luciferase)
  • Codon-optimized 
  • Tag: 6xHistidine in C-terminal
  • Subcloning restriction sites: AgeI (in 5’) and NheI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT

pUNO1Fc-SARS2-RBD

  • Strain: Wuhan-Hu-1 isolate
  • ORF size (RBD::hIgG1 Fc): 1473 bp
  • Signal sequence: exogenous (Lucia luciferase)
  • Codon-optimized
  • Tag: Human IgG1 Fc in C-terminal
  • Subcloning restriction sites: AgeI (in 5’) and MscI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - MscI generates blunt ends compatible with BaII, MIsI, MLuNI, Mox20I, and Msp20I restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Back to the top

Contents

pUNO1His-SARS2-RBD and pUNO1Fc-SARS2-RBD contents:

  • 20 μg of lyophilized DNA
  • 2 x 1 ml blasticidin at 10 mg/ml

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 ̊C.

stability Resuspended DNA should be stored at -20 ̊C and is stable up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions.

Store blasticidin at 4°C or -20°C for up to two years. The product is stable for 2 weeks at 37°C.

Avoid repeated freeze-thaw cycles.

Back to the top

Details

Learn more about the SARS-CoV-2 Spike protein here.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty