Invivogen
Menu

Tagged Spike RBD Production Vectors

pUNO1His-SARS2-RBD Unit size Cat. code Docs Qty Price
His-tagged SARS-CoV-2 RBD gene
20 µg
p1his-cov2-rbd
+-
$420.00
pUNO1Fc-SARS2-RBD Unit size Cat. code Docs Qty Price
Fc-tagged SARS-CoV-2 RBD gene
20 µg
p1fc-cov2-rbd
+-
$420.00

SARS-CoV-2 Spike RBD, codon-optimized & tagged in C-term

Schematic of tagged SARS2 Spike RBD production vectors
Schematic of tagged SARS2 Spike RBD production vectors

GENE DESCRIPTION

The SARS-CoV-2 (2019-nCoV) Spike RBD (receptor binding domain) has been identified as the key viral element allowing the virus docking to the target cells. RDB is recognized by the ACE2 surface membrane receptor [1-3]. RBD is a candidate for subunit prophylactic vaccines against SARS-CoVs [4, 5]. RBD is also at the center of therapeutic approaches, such as the development and testing of small peptide inhibitors or soluble ACE2 to block the SARS-CoV-2 entry into target cells [6].
pUNO1His-SARS2-RBD and pUNO1Fc-SARS2-RBD express a codon-optimized Spike RBD fused in C-terminus to the His- or Fc-tag, respectively. The coding sequence is preceded by an exogenous signal sequence to ensure effective protein secretion. (See Details and Specifications for more information)

 

PLASMIDS DESCRIPTION

pUNO1His-SARS2-RBD and pUNO1Fc-SARS2-RBD are designed for the production in mammalian cells of the Spike RBD. These vectors feature a potent mammalian expression cassette comprised of the strong SV40 enhancer, the ubiquitous human EF1α-HTLV composite promoter, and the SV40 polyadenylation (pAn) signal. The coding sequence is flanked by unique restriction sites, AgeI and NcoI at the 5' end, NheI at the 3' end of His-tag, and MscI at the 3' end of Fc-tag. Both plasmids are selectable with blasticidin in E. coli and mammalian cells.

 

QUALITY CONTROL

  • Fully sequenced ORFs
  • Predominant supercoiled conformation

 

The full Spike native gene is available in the pUNO1-SARS2-S expression plasmid.

 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Li F., 2016. Structure, function, and evolution of coronavirus spike proteins. Annu. Rev. Virol. 3:237-261.
2. Li F. et al., 2005. Structure of SARS coronavirus spike receptor-binding domain complexed with receptor. Science. 309:1864-1868.
3. Walls A.C. et al., 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.
4. Wang N. et al., 2020. Subunit vaccines against emerging pathogenic human coronaviruses. Front. Microbiol. 11:298. DOI: 10.3389/fmicb.2020.00298.
5. Padron-Regalado E., 2020. Vaccines for SARS-CoV-2: Lessons from other coronavirus strains. Infect. Dis. Ther. DOI: 10.1007/s40121-020-00300-x.
6. Monteil V.et al., 2020. Inhibition of SARS-CoV-2 infections in engineered human tissues using clinical-grade soluble human ACE2. Cell. 181:1-9.

Figures

SARS-CoV-2 Spike protein - RBD
SARS-CoV-2 Spike protein - RBD
Schematic of pUNO1His-SARS2-RBD His-tagged production vector
Schematic of pUNO1His-SARS2-RBD His-tagged production vector
Schematic of pUNO1Fc-SARS2-RBD Fc-tagged production vector
Schematic of pUNO1Fc-SARS2-RBD Fc-tagged production vector
Back to the top

Specifications

pUNO1His-SARS2-RBD

  • Strain: Wuhan-Hu-1 isolate
  • ORF size (RBD::His): 756 bp
  • Signal sequence: exogenous (Lucia luciferase)
  • Codon-optimized 
  • Tag: 6xHistidine in C-terminal
  • Subcloning restriction sites: AgeI (in 5’) and NheI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT

pUNO1Fc-SARS2-RBD

  • Strain: Wuhan-Hu-1 isolate
  • ORF size (RBD::hIgG1 Fc): 1473 bp
  • Signal sequence: exogenous (Lucia luciferase)
  • Codon-optimized
  • Tag: Human IgG1 Fc in C-terminal
  • Subcloning restriction sites: AgeI (in 5’) and MscI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - MscI generates blunt ends compatible with BaII, MIsI, MLuNI, Mox20I, and Msp20I restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Back to the top

Contents

pUNO1His-SARS2-RBD and pUNO1Fc-SARS2-RBD contents:

  • 20 μg of lyophilized DNA
  • 2 x 1 ml blasticidin at 10 mg/ml

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 ̊C.

stability Resuspended DNA should be stored at -20 ̊C and is stable up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions.

Store blasticidin at 4°C or -20°C for up to two years. The product is stable for 2 weeks at 37°C.

Avoid repeated freeze-thaw cycles.

Back to the top

Details

Spike (S) is a multifunctional glycoprotein that mediates the SARS-CoV-2 entry into the target cells [1, 2]. Most of the current knowledge about the SARS-CoV-2 Spike is based on analogies with findings on the SARS-CoV Spike. At the surface of the virus, Spike is a clove-shaped trimer. Each Spike protomer contains three segments: a large ectodomain, a transmembrane anchor (TM), and a short intracellular tail (IC) [1-3]. The Spike ectodomain contains three critical elements: the S1 subunitthe RBD (receptor binding domain), and the S2 subunit. Two cleavage sites at the S1 and S2 boundary (S1/S2) and in the S2 domain (S2’) play an essential role in the viral entry into host target cells [3-5].

The Spike trimer exists in two structurally distinct conformations: pre-fusion and post-fusion. In its pre-fusion state, the Spike is a "closed" clove-shape with three S1 heads and a trimeric S2 stalk. The S1 "closed" conformation exerts a physical constraint on the S2 subunit until specific proteases cleave the S1/S2 and S2' sites [3]. The RBDs is located in the S1-CTD region and is buried in the inner S1 head-trimer. The S1 "open" conformation is expected to be necessary for binding to the ACE2 receptor at the surface of host target cells [3, 4]. The opening of the S1-CTD is thus expected to be necessary for binding to ACE2. The exact mechanisms driving the opening of an S1-CTD domain and exposition of RBD so that it can bind the ACE2 receptor are not elucidated yet. It has been proposed that the S protein is cleaved into S1 and S2 subunits by proteases, including furin and the host surface-associated transmembrane protease serine 2 (TMPRSS2) [3-5]. S1 binds to ACE2 through RBD, and S2 is further cleaved and activated by TMPRSS2 [3, 4]. Together these actions result in host-viral membrane fusion and the viral RNA genome is released into the host cell cytoplasm.

The previous SARS-CoV and MERS-CoV outbreaks have prompted the search for protective vaccines. Among the different strategies, protein vaccination using the full Spike or its S1 or RBD fragments, have provided encouraging results in pre-clinical studies [6], and some have reached a clinical-stage (phase I) [7]. One clinical trial testing a prophylactic SARS-CoV-2 vaccine based on the full-length Spike mRNA has been launched in March 2020 [NCT04283461].

 

References

1. Li F., 2016. Structure, function, and evolution of coronavirus spike proteins. Annu. Rev. Virol. 3:237-261.
2. Li F. et al., 2005. Structure of SARS coronavirus spike receptor-binding domain complexed with receptor. Science. 309:1864-1868.
3. Walls A.C. et al., 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.
4. Hoffmann M. et al., 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
5. Hoffmann M.  et al., 2020. A multibasic cleavage site in the Spike protein of SARS-CoV-2 is essential for infection of human lung cells. Molecular Cell. 78:1-6.
6. Wang N. et al., 2020. Subunit vaccines against emerging pathogenic human coronaviruses. Front. Microbiol. 11:298. DOI: 10.3389/fmicb.2020.00298.
7. Padron-Regalado E., 2020. Vaccines for SARS-CoV-2: Lessons from other coronavirus strains. Infect. Dis. Ther. DOI: 10.1007/s40121-020-00300-x.

 

Back to the top
Customer Service
& Technical Support
Shopping cart is empty