Invivogen
Menu

ODN 2006 FITC

ODN 2006 FITC Unit size Cat. code Docs Qty Price
Class B - FITC-labeled ODN 2006
50 µg
tlrl-2006f
+-
$145.00

FITC labeled CpG oligonucleotide - Human TLR9 ligand

ODN   2006 FITC is a CpG ODN class B with a preference for human TLR9.

ODN 2006 FITC can be used to evaluate CpG ODN cellular uptake and localization by  confocal laser-scanning microscopy (excitation 495 nm, emission 520 nm) or flow cytometry.

CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs).

These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA.

They have been shown to induce a coordinated set of immune responses based on the activation of immune cells primarily involved in the recognition of these molecules.

Back to the top

Specifications

Synonyms:ODN 7909, PF_3512676

Specificity: human TLR9 agonist

Working concentration: 1 - 5 μM

ODN 2006 sequence : 5’- tcgtcgttttgtcgttttgtcgtt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).

Spectral Properties of FITC
Excitation λ max: 495 nm
Emission λ max: 520 nm

Back to the top

Contents

  • 50 μg (6.2 nmol) lyophilized ODN 2006 labeled with FITC at the 3’ terminus
  • 1 ml sterile endotoxin-free water

room temperature FITC ODN 2006 is shipped at room temperature

store Stored at -20°C. Protect from light. Resuspended product should be stored at -20°C and protected from light.

stable Product is stable for 6 months.

Alert Avoid repeated cycles of freeze-thaw.

Back to the top

Citations

Load more
Customer Service
& Technical Support
Shopping cart is empty