Invivogen
Menu

ODN 2006 FITC

ODN 2006 FITC Unit size Cat. code Docs Qty Price
Class B - FITC-labeled ODN 2006
50 µg
tlrl-2006f
+-
$121.00

FITC labeled CpG oligonucleotide - Human TLR9 ligand

CpG   ODNs are synthetic oligonucleotides that contain unmethylated CpG   dinucleotides in particular sequence contexts (CpG motifs).

These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA.

They have been shown to induce a coordinated set of immune responses based on the activation of immune cells primarily involved in the recognition of these molecules.

ODN   2006 FITC is a CpG ODN class B with a preference for human TLR9.

ODN 2006 FITC can be used to evaluate CpG ODN cellular uptake and localization by  confocal laser-scanning microscopy (excitation 495 nm, emission 520 nm) or flow cytometry.

Back to the top

Specifications

Synonyms:ODN 7909, PF_3512676

Specificity: human TLR9 agonist

Working concentration: 1 - 5 μM

ODN 2006 sequence : 5’- tcgtcgttttgtcgttttgtcgtt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).

Spectral Properties of FITC
Excitation λ max: 495 nm
Emission λ max: 520 nm

Back to the top

Contents

  • 50 μg (6.2 nmol) lyophilized ODN 2006 labeled with FITC at the 3’ terminus
  • 1 ml sterile endotoxin-free water

room temperature FITC ODN 2006 is shipped at room temperature

store Stored at -20°C. Protect from light. Resuspended product should be stored at -20°C and protected from light.

stable Product is stable for 6 months.

Alert Avoid repeated cycles of freeze-thaw.

Back to the top

Customer Service
& Technical Support

CAPTCHA
In order to prevent automated spam submissions, please answer the following question:
10 + 2 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Shopping cart is empty