ODN 2006 FITC
ODN 2006 FITC | Unit size | Cat. code | Docs | Qty | Price |
---|---|---|---|---|---|
Class B - FITC-labeled ODN 2006 |
50 µg |
tlrl-2006f |
FITC labeled CpG oligonucleotide - Human TLR9 ligand
ODN 2006 FITC is a CpG ODN class B with a preference for human TLR9.
ODN 2006 FITC can be used to evaluate CpG ODN cellular uptake and localization by confocal laser-scanning microscopy (excitation 495 nm, emission 520 nm) or flow cytometry.
CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs).
These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA.
They have been shown to induce a coordinated set of immune responses based on the activation of immune cells primarily involved in the recognition of these molecules.
Back to the topSpecifications
Synonyms:ODN 7909, PF_3512676
Specificity: human TLR9 agonist
Working concentration: 1 - 5 μM
ODN 2006 sequence : 5’- tcgtcgttttgtcgttttgtcgtt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).
Spectral Properties of FITC
Excitation λ max: 495 nm
Emission λ max: 520 nm
Contents
- 50 μg (6.2 nmol) lyophilized ODN 2006 labeled with FITC at the 3’ terminus
- 1 ml sterile endotoxin-free water
FITC ODN 2006 is shipped at room temperature
Stored at -20°C. Protect from light. Resuspended product should be stored at -20°C and protected from light.
Product is stable for 6 months.
Avoid repeated cycles of freeze-thaw.