Invivogen
Menu

Human TLR9 Agonist Kit

Human TLR9 Agonist Kit Unit size Cat. code Docs Qty Price
Set of known agonists for human TLR9
1 kit
tlrl-kit9h
+-
$405.00

Set of known agonists for human TLR9

This kit features the most widely known CpG ODNs from Class A, B or C that function best with human cells.

These CpG ODNs are often cited in the literature.

This kit will help you to choose the most suitable class of CpG ODNs for your studies in human cells.

 

Back to the top

Specifications

Specificity: Human TLR9 agonists

Quality control:

Sequences:
ODN 2006 (class B): 5’- tcgtcgttttgtcgttttgtcgtt-3’ (24 mer)
ODN 2006 Control: 5’- tgctgcttttgtgcttttgtgctt-3’ (24 mer)
ODN 2216 (class a): 5’- ggGGGACGA:TCGTCgggggg-3’ (20 mer)
ODN 2243 (ODN 2216 Control): 5’- ggGGGAGCATGCTGgggggg-3’ (20 mer)
ODN 2395 (class C): 5’- tcgtcgttttcggcgc:gcgccg-3’ (22 mer)
ODN 2395 Control: 5’- tgctgcttttggggggcccccc -3’ (22 mer)
Note: Bases shown in capital letters are phosphodiester, those in lower case are phosphorothioate (nuclease resistant) and palindrome is underlined.

Back to the top

Contents

ODNs are provided lyophilized:

  • 100 μg (13.0 nmol) ODN 2006 (ODN 7909).
  • 100 μg (13.0 nmol) ODN 2006 Control (ODN 2137).
  • 100 μg (15.5 nmol) ODN 2216.
  • 100 μg (15.5 nmol) ODN 2243 (ODN 2216 Control).
  • 100 μg (14.2 nmol) ODN 2395.
  • 100 μg (14.2 nmol) ODN 2395 Control.
  • 1.5 ml endotoxin-free water.

Products are shipped at room temperature.

Upon receipt it should be stored at -20°C.

Back to the top

Description

CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs).

These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA [1].

CpG ODNs are recognized by Toll-like receptor 9 (TLR9) leading to strong immunostimulatory effects.

 

ODN2006 (also known as ODN 7909 or PF-3512676) is a class B CpG ODN with a preference towards human TLR9. Class B CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. They strongly activate B cells but weakly stimulate IFN-α secretion.

 

ODN 2006 Control (also known as ODN 2173) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 2006. Note: In some cell types, ODN 2006 Control may stimulate cell activity, including the production of cytokines [2].

 

ODN 2216 is a CpG ODN class A with a preference towards human TLR9. Class A CpG ODNs are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string.
They induce high IFN-α production from plasmacytoid dendritic cells (pDC) but are weak stimulators of TLR9-dependent NF-kB signaling.

 

ODN 2243 (also known as ODN 2216 Control) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 2216.

 

ODN 2395 is a CpG ODN class C for human and mouse TLR9. Class C CpG ODNs combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif. Class C CpG ODNs induce strong IFN-α production from pDC and B cell stimulation.

 

ODN 2395 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control with ODN 2395.

 

1. Bauer, S. et al., 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98(16):9237-42.
2. reid G. et al., 2005. CpG stimulation of precursor B-lineage acute lymphoblastic leukemia induces a distinct change in costimulatory molecule expression and shifts allogeneic T cells toward a Th1 response. Blood 105(9):3641-7.

Back to the top

Customer Service
& Technical Support

CAPTCHA
In order to prevent automated spam submissions, please answer the following question:
11 + 0 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Shopping cart is empty