Invivogen
Menu

3p-hpRNA [ NEW ]

3p-hpRNA Unit size Cat. code Docs Qty Price
5’ triphosphate hairpin RNA
25 µg
tlrl-hprna
+-
$145.00

NEW PRODUCT

RIG-I Agonist

3p-hpRNA is a 5’ triphosphate hairpin RNA that was generated by in vitro transcription of a sequence from the influenza A (H1N1) virus, a single‑stranded negative‑sense RNA virus [1,2].

This 87-mer RNA oligonucleotide contains an uncapped 5’ triphosphate extremity and a double strand fragment. 3p-hpRNA sequence self-anneals to form secondary structures such hairpin or panhandle conformations. These structural features, which distinguish viral RNA from mammalian RNA, are recognized by retinoic acid-inducible gene I (RIG‑I), the founding member of the RIG-I like receptor (RLR) family [3,4].

RLRs are important cytosolic sensors for the detection of viral RNA. Upon activation, RIG-I recruits the adaptor mitochondrial antiviral signaling protein (MAVS, or IPS-1/VISA/Cardif) which then triggers signaling cascades that lead to the production of type I interferons and pro-inflammatory cytokines [5].

3p-hpRNA is a specific agonist of RIG-I; it does not activate other dsRNA sensors such as TLR3 and MDA‑5.

Of note, this ligand induces stronger RIG-I responses than 5’ppp‑dsRNA, a fully synthetic RIG-I ligand.

 

1. Rehwinkel J. et al., 2010. RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell. 140:397-408.
2. Liu G. et al., 2015. Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and Interferon Induction. J Virol. 89(11):6067-79.
3. Hornung V. et al., 2006. 5’-triphosphate RNA is the ligand for RIGI. Science. 314:994-7.
4. Gebhardt A. et al., 2017. Discrimination of Self and Non-Self Ribonucleic Acids. Journal of Interferon & Cytokine Research 37: 184-97.
5. Yoneyama M. et al., 2015. Viral RNA detection by RIG-I-like receptors. Curr Opin Immunol. 32:48-53.

 

 


A549-Dual™ cell stimulation with 3p-hpRNA induces higher ISG and NF-κB responses than with 5’ ppp-RNA.
Dose responses of A549-derived cells stimulated with 0.1-100 ng/ml 3p-hpRNA/LyoVec™ or 0.3 ng/ml to 1 μg/ml 5’ppp-dsRNA/LyoVec™. After overnight incubation, the ISG response was assessed by determining Lucia luciferase activity in the supernatant using QUANTI-Luc™ and expressed as relative light units (RLUs) (a), and the NF-κB response was determined using QUANTI‑Blue™, a SEAP detection reagent, and by reading the optical density (OD) at 655 nm (b).


RAW-Lucia™ and HEK-Lucia™ RIG-I cell stimulation with 3p-hpRNA induces a better ISG response than with 5’ ppp-RNA.
RAW-derived (a) and HEK-derived (b) cells were stimulayed with 1 μg/ml 5’ppp-dsRNA/LyoVec™ or 3p-hpRNA/LyoVec™. After overnight incubation, the ISG response was assessed by determining Lucia luciferase activity in the supernatant using QUANTI-Luc™ and expressed as relative light units (RLUs).

Back to the top

Specifications

Specificity: RIG-I agonist
Working Concentration:
 10 ng- 1 μg/ml
Molecular Weight: 28995 g/mol

Quality Control:
- The biological activity has been verified using A549-Dual™ cells.
- The absence of bacterial contamination, lipoproteins and endotoxins, hasbeen confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.

Sequence:
5’-pppAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAA
ACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUU
GGCAUGUCCGCAAAC- 3’ (87 mer)

3p-hpRNA was prepared by in vitro transcription with T7 RNA polymerase. This sequence self-anneals to form secondary structures such as hairpin or panhandle conformations.

Back to the top

Contents

  • 25 μg lyophilized 3p-hpRNA (5’ triphosphate hairpin RNA)
  • 1.5 ml sterile endotoxin-free water

3p-hpRNA is shipped at room temperature.

Store lyophilized 3p-hpRNA at -20°C or at 80°C. Upon resuspension, prepare aliquots and store 3p-hpRNA at -20°C.

Resuspended product is stable for 3 months at -20°C.

Note: Avoid repeated freeze-thaw cycles.

Back to the top

Customer Service
& Technical Support

CAPTCHA
In order to prevent automated spam submissions, please answer the following question:
5 + 8 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Shopping cart is empty