Invivogen
Menu

Lambda Variant (C.37) Spike Pseudotyping Vector

pLV-SpikeV9 Unit size Cat. code Docs Qty Price
Spike pseudotyping plasmid - Lambda Variant (C.37)
20 µg
plv-spike-v9
+-
$409.00

For lentiviral particle pseudotyping with the SARS-CoV-2 Spike (C.37 - Peruvian origin) 

pLV-SpikeV9 has been specifically designed for the pseudotyping of lentiviral particles with the SARS-CoV-2 Spike (S) protein when co-transfected with plasmids encoding a reporter and accessory proteins (not provided). pLV-SpikeV9 encodes the full-length Spike sequence from the Lambda variant (C.37), and for optimal expression, it is codon-optimized and the C‑terminal ER-retention signal has been removed [1, 2].

 More details

 

Lambda Variant (C.37 lineage) Spike pseudotyping vector
Lambda Variant (C.37 lineage) Spike pseudotyping vector

Gene Description

This plasmid encodes the Spike protein from the SARS-CoV-2 Lambda variant, first reported in Peru. This variant is classified as a member of Clade GR/452Q.V1/ C.37 lineage (Nextstrain/Pango lineage classification). It is characterized by the presence of mutations within the Spike coding region, of which, several are of concern [3,4].

  • S1 domain: G75V, T76I, deletion (Δ)R246-G252, D253N, D614G
  • RBD: L452Q, F490S
  • S2 domain: T859N

Learn more about the emerging SARS-CoV-2 variants around the world

 

General Plasmid Description

This plasmid features a potent mammalian expression cassette composed of the ubiquitous human-(h)CMV composite promoter, a rabbit β-globin intron directly upstream of the spike gene, and a rabbit β-globin polyadenylation (pAn) signal. The spike coding sequence includes the SARS-CoV-2 signal sequence and the S1/S2 furin cleavage site [5]. These plasmids are selectable with ampicillin in E. coli.

 

Applications

  • Generation of Spike pseudotyped lentiviral particles upon co-transfection with reporter and accessory protein plasmids (not provided).
  • Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma.

 

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/
4. https://outbreak.info/situation-reports
5. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Back to the top

Specifications

  • Origin: Lambda variant (C.37 lineage)
  • Sequence Reference: EPI_ISL_3940379
  • Codon Optimized
  • ORF size: 3744 bp
  • Sequencing primers:
    - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
    - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.
Back to the top

Contents

pLV-SpikeV9 is provided as follows:

  • 20 μg of lyophilized DNA

 

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Back to the top

Details

Spike-pseudotyping of lentiviral particles

InvivoGen's pLV-Spike plasmid collection has been designed for pseudotyping lentiviral particles with the SARS-CoV-2 Spike (S) protein. The S protein a structural glycoprotein expressed on the surface of SARS‑CoV-2. It mediates membrane fusion and viral entry into target cells upon binding to the host receptor ACE2 and its cleavage by cellular proteases such as TMPRSS2 [1]. Notably, the C‑terminal cytoplasmic tail of the S protein encodes a presumptive endoplasmic reticulum (ER)‑retention motif (KxHxx), which has previously been shown to enable the accumulation of SARS‑CoV S proteins at the ER‑Golgi intermediate compartment (ERGIC) and facilitate their incorporation into new virions [2]. The removal of this motif (d19) has been shown to increase the expression of the spike protein in pseudovirions [3,4].

Pseudotyped particle production involves the co-transfection of 293T cells with a reporter protein vector (e.g. GFP), one or several plasmids encoding the necessary lentiviral proteins, and the pseudotyping pLV-Spike plasmids. The transfected cells produce SARS‑CoV‑2 Spike (S)‑pseudotyped lentiviral particles, which can then be used to infect permissive cells, such as ACE2‑expressing HEK293-derived cells and ACE2‑TMPRSS2‑expressing A549-derived cells.

 

References

1. Hoffmann M. et al. 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
2. Ujike, M. et al. 2016. The contribution of the cytoplasmic retrieval signal of severe acute respiratory syndrome coronavirus to intracellular accumulation of S proteins and incorporation of S protein into virus-like particles. J Gen Virol 97, 1853-1864.
3. Johnson, M.C. et al. 2020. Optimized pseudotyping conditions for the SARS-COV2 Spike glycoprotein. J Virol. 94(21):e01062-20
4. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty