FITC labeled CpG oligonucleotide - Human TLR9 ligand

CpG   ODNs are synthetic oligonucleotides that contain unmethylated CpG   dinucleotides in particular sequence contexts (CpG motifs). These CpG   motifs are present at a 20-fold greater frequency in bacterial DNA   compared to mammalian DNA. They have been shown to induce a coordinated   set of immune responses based on the activation of immune cells   primarily involved in the recognition of these molecules.

ODN   2006 FITC is a CpG ODN class B with a preference for human TLR9. ODN 2006 FITC can   be used to evaluate CpG ODN cellular uptake and localization by  confocal laser-scanning microscopy (excitation 495 nm, emission 520 nm)   or flow cytometry.


Synonyms: ODN 7909, PF_3512676

Specificity: human TLR9 agonist

Working concentration: 1 - 5 μM

ODN 2006 sequence
5’- tcgtcgttttgtcgttttgtcgtt -3’ (24 mer)
Note: Bases are phosphorothioate (nuclease resistant).

Spectral Properties of FITC
Excitation λ max: 495 nm
Emission λ max: 520 nm


• 50 μg (6.2 nmol) lyophilized ODN 2006 labeled with FITC at the 3’ terminus
• 1 ml sterile endotoxin-free water

FITC ODN 2006 is shipped at room temperature and should be stored at -20°C. Protect from light. Resuspended product should be stored at -20°C and protected from light. Product is stable for 6 months. Avoid repeated cycles of freeze-thaw.



Description Class B - FITC-labeled ODN 2006
Cat. Codetlrl-2006f
Unit Size50 µg
Price For price or distributor address,
please select your country
Disclaimer: Our products are provided for research purpose only. Commercial applications may require licensing from third parties.
Note that the sequence of available ORFs provided by InvivoGen can differ from a given reference Genbank record due to genetic variations and/or alternative splicing. Customers should verify that the version of a gene sold by InvivoGen is suitable for the customer needs.
Copyrights © 2011-2016 InvivoGen. All Rights Reserved. Reproduction of any materials from this site is strictly forbidden without permission for commercial use. Nonprofit use for non-commercial research and educational purposes is permitted, citation should include the URL "www.invivogen.com".