Invivogen
Menu

3p-hpRNA - RIG-I agonist

Product Unit size Cat. code Docs. Qty. Price

3p-hpRNA

5’ triphosphate hairpin RNA

Show product

25 µg

4 x 25 µg

tlrl-hprna
+-
$217

RIG-I agonist

3p-hpRNA structure and signaling
3p-hpRNA structure and signaling

3p-hpRNA is a 5’ triphosphate hairpin RNA that was generated by in vitro transcription of a sequence from the influenza A (H1N1) virus, a single‑stranded negative‑sense RNA virus [1,2]. This 89-mer RNA oligonucleotide contains an uncapped 5’ triphosphate extremity and a double-strand fragment. 3p-hpRNA sequence self-anneals to form secondary structures such as hairpin or panhandle conformations. These structural features, which distinguish viral RNA from mammalian RNA, are recognized by retinoic acid-inducible gene I (RIG‑I) [3,4]. RIG-I is a cytoplasmic RNA helicase that belongs to the RIG-I-like receptors (RLRs) family and triggers an antiviral immune response by the activation of type-I interferons (IFN-α and -β) [5].

To achieve stimulation of RIG-I, 3p-hpRNA must be delivered into the cytoplasm, for example by using a transfection agent, such as LyoVec™. Of note, this ligand induces stronger RIG-I responses than 5’ppp‑dsRNA, a fully synthetic RIG-I ligand.

Key Features of 3p-hpRNA:

 

COVID-19 related research

Type I interferons (IFNα/β) are the prototypical antiviral cytokines. Inducers of these cytokines, such as the RIG-I agonist, 3p-hpRNA a 5’ triphosphate hairpin RNA, can be used to study the innate immune response to SARS-CoV-2.

 

References:

1. Rehwinkel J. et al., 2010. RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell. 140:397-408.
2. Liu G. et al., 2015. Influenza A Virus Panhandle Structure Is Directly Involved in RIG-I Activation and IFN Induction. J Virol. 89(11):6067-79.
3. Hornung V. et al., 2006. 5’-triphosphate RNA is the ligand for RIGI. Science. 314:994-7.
4. Gebhardt A. et al., 2017. Discrimination of Self and Non-Self Ribonucleic Acids. Journal of IFN & Cytokine Research 37: 184-97.
5. Yoneyama M. et al., 2015. Viral RNA detection by RIG-I-like receptors. Curr Opin Immunol. 32:48-53.

 

Read our review Read our review on RIG-I and cancer immunotherapy.

Figures

A549-Dual™ cellular response to 3p-hpRNA and 5`ppp-dsRNA
A549-Dual™ cellular response to 3p-hpRNA and 5`ppp-dsRNA

A549-Dual™ cell stimulation with 3p-hpRNA induces higher ISG and NF-κB responses than with 5’ppp-dsRNA.
Dose responses of A549-derived cells stimulated with 0.1-100 ng/ml 3p-hpRNA (complexed to LyoVec™) or 0.3 ng/ml to 1 μg/ml 5’ppp-dsRNA (complexed to LyoVec™). After overnight incubation, the ISG response was assessed by determining Lucia luciferase activity in the supernatant using QUANTI-Luc™ 4 Lucia/Gaussia and expressed as relative light units (RLUs) (a), and the NF-κB response was determined using QUANTI-Blue™ Solution, a SEAP detection reagent, and by reading the optical density (OD) at 655 nm (b).

Cellular response to 3p-hpRNA and 5’ppp-dsRNA
Cellular response to 3p-hpRNA and 5’ppp-dsRNA

RAW-Lucia™ and HEK-Lucia™ RIG-I cell stimulation with 3p-hpRNA induces a better ISG response than with 5’ppp-dsRNA.

RAW-derived (a) and HEK-derived (b) cells were stimulated with 1 μg/ml 5’ppp-dsRNA (complexed to LyoVec™) or 3p-hpRNA (complexed to LyoVec™).
After overnight incubation, the ISG response was assessed by determining Lucia luciferase activity in the supernatant using QUANTI-Luc™ 4 Lucia/Gaussia and expressed as relative light units (RLUs).

Back to the top

Specifications

Specificity: RIG-I agonist

Sequence:
5’-pppGGAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUUGGCAUGUCCGCAAAC- 3’ (89 mer)

3p-hpRNA was prepared by in vitro transcription with T7 RNA polymerase. This sequence self-anneals to form secondary structures such as hairpin or panhandle conformations.

Formulation: Naked 

Working Concentrations: 10 ng- 1 μg/ml 

Quality Control:

  • The biological activity has been verified using cellular assays.
  • The absence of bacterial contamination (lipoproteins and endotoxins) has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.

 

 

Back to the top

Contents

3p-hpRNA is available in two quantities:

tlrl-hprna:

  • 25 μg 3p-hpRNA (naked).
  • 1.5 ml sterile endotoxin-free water.

tlrl-hprna-100:

  • 4 x 25μg 3p-hpRNA (naked).
  • 10 ml sterile endotoxin-free water.

 

3p-hpRNA is provided lyophilized and shipped at room temperature.

Store lyophilized 3p-hpRNA at -20°C.

Lyophilized product is stable for 1 year when stored -20°C.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty