Mouse TLR9 Agonist Kit

Set of known agonists for mouse TLR9

This kit contains archetypal CpG ODNs of the A-, B- or C-class described for mice cells immunostimulation via TLR9.

Choose the most suitable class of ODN for your studies, from:

- ODN 1585 and ODN 1585 control - A-class
- ODN 1826 and ODN 1826 control - B class
- ODN 2395 and ODN 2395 control - C-class


Specificity: Murine TLR9 agonists

Quality control
- TLR9 activity has been tested using HEK-Blue™ TLR9 cells.
- The absence of bacterial contamination (e.g. lipoproteins and endotoxins) has been confirmed using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.

ODN 1585 (class a): 5’- ggGGTCAACGTTGAgggggg -3’ (20 mer)
ODN 1585 Control: 5’- ggGGTCAAGCTTGAgggggg-3'' (20 mer)

ODN 1826 (class B): 5’- tccatgacgttcctgacgtt-3’ (20 mer)
ODN 1826 Control: 5’- tccatgagcttcctgagctt -3’ (20 mer)

ODN2395 (class C): 5’- tcgtcgttttcggcgc:gcgccg-3’
ODN 2395 Control: 5’- tgctgcttttggggggcccccc -3’

Note: Bases shown in capital letters are phosphodiester, those in lower case are phosphorothioate (nuclease resistant) and palindrome is underlined.


ODNs are provided lyophilized:
• 100 μg (15.51 nmol) ODN 1585
• 100 μg (15.51 nmol) ODN 1585 Control
• 100 μg (15.71 nmol) ODN 1826
• 100 μg (15.71 nmol) ODN 1826 Control (ODN 2138)
• 100 μg (14.18 nmol) ODN 2395
• 100 μg (14.18 nmol) ODN 2395 Control
• 1.5 ml endotoxin-free water

Products are shipped at room temperature and should be stored at -20°C.


CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs). These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA [1, 2].

CpG ODNs are recognized by Toll-like receptor 9 (TLR9) leading to strong immunostimulatory effects.

• ODN 1585 is a class A CpG ODN with a preference towards mouse TLR9. Class A CpG ODNs are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string.
They induce high IFN-a production from plasmacytoid dendritic cells (pDC) but are weak stimulators of TLR9-dependent NF-kB signaling.

• ODN 1585 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1585.

• ODN 1826 is a class B CpG ODN with a preference towards mouse TLR9. Class B CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. They strongly activate B cells but weakly stimulate IFN-α secretion.

• ODN 1826 Control (also known as ODN 2138) contains GpC dinucleotides instead of CpGs and can be used as a negative control together with ODN 1826.

• ODN 2395 is a class C CpG ODN for human and mouse TLR9. Class C CpG ODNs combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif. Class C CpG ODNs induce strong IFN-α production from pDC and B cell stimulation.

• ODN 2395 Control contains GpC dinucleotides instead of CpGs and can be used as a negative control with ODN 2395.

1. Krieg am. et al., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature, 374(6522):546-9.
2. Bauer, S. et al., 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. PNAS 98(16):9237-42.


Mouse TLR9 Agonist Kit

Description Set of known agonists for mouse TLR9
Cat. Codetlrl-kit9m
Unit Size1 kit
Price For price or distributor address,
please select your country
Disclaimer: Our products are provided for research purpose only. Commercial applications may require licensing from third parties.
Note that the sequence of available ORFs provided by InvivoGen can differ from a given reference Genbank record due to genetic variations and/or alternative splicing. Customers should verify that the version of a gene sold by InvivoGen is suitable for the customer needs.
Copyrights © 2011-2016 InvivoGen. All Rights Reserved. Reproduction of any materials from this site is strictly forbidden without permission for commercial use. Nonprofit use for non-commercial research and educational purposes is permitted, citation should include the URL "".