Invivogen
Menu

Truncated Spike (S) Expression Vectors

pUNO1-SARS2-S-d19 Unit size Cat. code Docs Qty Price
Truncated SARS-CoV-2 Spike with ER-retention signal removed from the wild-type gene (Wuhan-Hu-1 isolate)
20 µg
puno1-cov2-sd19
+-
$397.00
pUNO1-SARS2-S-d19 (D614G) Unit size Cat. code Docs Qty Price
Truncated SARS-CoV-2 Spike with ER-retention signal removed and the D614G point mutation
20 µg
puno1-cov2-sd19g
+-
$397.00

Truncated SARS-CoV-2 Spike coding sequence with ER-retention signal removed

GENE DESCRIPTION

Spike (S) is a structural glycoprotein expressed on the surface of SARS‑CoV-2. It mediates membrane fusion and viral entry into target cells upon binding to the host receptor ACE2 and the proteolytic activity of TMPRSS2 [1]. The S protein consists of an N-terminal ectodomain, a transmembrane anchor, and a short C-terminal cytoplasmic tail. The ectodomain contains the S1 subunit, which encodes the receptor-binding domain (RBD), a key target in treatment and vaccination strategies against COVID-19, as well as the S2 subunit, needed for membrane fusion [2]. Notably, the C-terminal cytoplasmic tail of the S protein encodes a presumptive endoplasmic reticulum (ER)-retention motif (KxHxx), which has previously been shown to enable the accumulation of SARS‑CoV S proteins at the ER-Golgi intermediate compartment (ERGIC) and facilitate their incorporation into new virions [3]. 

pUNO1-SARS2-S-d19 (D614 or D614G) plasmids encode the spike coding sequence from the original SARS-CoV-2 Wuhan‑Hu-1 (D614) isolate or with the globally-dominant D614G mutation (G614-variant) [4]. Furthermore, to improve the expression of the S protein in pseudovirions and cell lines as reported in the literature, the last 19 amino acids (d19), which contain the ER-retention motif, have been removed [5,6].

Schematic of truncated SARS-CoV-2 Spike (d19) expression vector
Schematic of truncated SARS-CoV-2 Spike (d19) expression vector

 

PLASMID DESCRIPTION

pUNO1-SARS2-S-d19 (D614 or D614G) plasmids feature a potent mammalian expression cassette composed of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal. The coding sequence includes the SARS-CoV-2 signal sequence and the S1/S2 furin cleavage site. The ORF is flanked by unique restriction sites (AgeI and NheI) to facilitate subcloning of the untagged gene of interest. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells and can be used for transient or stable transfection. 

 

QUALITY CONTROL

  • Fully sequenced ORF
  • Predominant supercoiled conformation

 

For plasmids designed for the production of His- or Fc-tagged Spike (D614 or G614-variant) ectodomains click here.

 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Hoffmann M. et al., 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
2. Walls A.C., et al., 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.
3. Ujike, M. et al. 2016. The contribution of the cytoplasmic retrieval signal of severe acute respiratory syndrome coronavirus to intracellular accumulation of S proteins and incorporation of S protein into virus-like particles. J Gen Virol 97, 1853-1864.
4. Korber B. et al., 2020. Tracking changes in SARS-CoV-2 Spike: evidence that D614G increases infectivity of the COVID-19 virus. Cell. 182:1-16.
5. Johnson, M.C. et al. 2020. Optimized pseudotyping conditions for the SARS-COV2 Spike glycoprotein. bioRxiv
6. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.

Back to the top

Specifications

pUNO1-SARS2-S-d19 (D614):

  • Origin: Wuhan-Hu-1 isolate
  • Genbank: NC_045512.2 (original sequence)
  • ORF size: 3765 bp 
  • Subcloning restriction sites in pUNO1: AgeI (in 5’) and NheI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT

pUNO1-SARS2-S-d19 (D614G):

  • Origin: pUNO1-SARS2-S with D614G mutation (original sequence)
  • ORF size: 3765 bp
  • Subcloning restriction sites in pUNO1: AgeI (in 5’) and NheI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Back to the top

Contents

pUNO1-SARS2-S-d19 (D614 or D614G) are provided as follows:

  • 20 μg of lyophilized DNA
  • 2 x 1 ml Blasticidin at 10 mg/ml

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

AlertAvoid repeated freeze-thaw cycles.

Back to the top

Details

Learn more about the SARS-CoV-2 spike protein here.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty