Invivogen
Menu

Tagged Spike S2 Production Vectors

pUNO1His-SARS2-S2 Unit size Cat. code Docs Qty Price
His-tagged SARS-CoV-2 S2 gene
20 µg
p1his-cov2-s2
+-
$433.00
Backorder
pUNO1Fc-SARS2-S2 Unit size Cat. code Docs Qty Price
Fc-tagged SARS-CoV-2 S2 gene
20 µg
p1fc-cov2-s2
+-
$433.00
Backorder

Optimized and tagged Spike S2 gene for protein purification

Schematic of tagged SARS2 Spike S2 domain production vectors
Schematic of tagged SARS2 Spike S2 domain production vectors

InvivoGen offers two plasmids that have been specifically designed for the expression and production of the S2 subunit of the SARS-CoV-2 Spike (S). These plasmids encode the full-length S2 subunit from the original Wuhan-Hu-1 isolate, fused to a C-terminal His- or Fc-tag, to facilitate protein purification.

  • pUNO1His-SARS2-S2 – His-tagged Spike S2 subunit
  • pUNO1Fc-SARS2-S2 – Fc-tagged Spike S2 subunit

For optimal cellular expression and protein secretion, the gene is codon-optimized and preceded by the native SARS-CoV-2 signal sequence.

 

Gene Description

These plasmids encode the S2 subunit of the Spike (S) protein from the SARS-CoV-2 Wuhan-Hu-1 isolate, first reported in December 2019 [1]. The S protein facilitates host cell receptor recognition, cell attachment, and fusion during infection. In particular, the Spike S2 subunit comprised of a fusion peptide (FP) and heptad repeats (HR), as well as transmembrane and cytoplasmic domains, plays a crucial role in viral fusion and entry [2,3]. Notably, the S2 subunit is highly conserved with very few mutations reported in the variants of concern.

Learn more about the emerging SARS-CoV-2 variants around the world

 

Plasmid Description

These plasmids feature a potent mammalian expression cassette comprised of the strong SV40 enhancer, the ubiquitous human EF1α-HTLV composite promoter, and the SV40 polyadenylation (pAn) signal. Furthermore, the codon-optimized ORF is preceded by the native SARS-CoV-2 signal sequence to ensure efficient protein secretion. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells (transient and stable transfection).

 

Applications

  • Expression of the Spike S2 subunit tagged with a C-terminal Fc- or His-tag
  • Production and purification of Spike S2 subunit for antibody screening (i.e. ELISA)
 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Zhou, P. et al. 2020. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270-273.
2. Huang, Y. et al. 2020. Structural and functional properties of SARS-CoV-2 spike protein: potential antivirus drug development for COVID-19. Acta Pharmacol Sin 41, 1141-1149.
3. Ng, K.T. et al. 2021. Spike S2 Subunit: The Dark Horse in the Race for Prophylactic and Therapeutic Interventions against SARS-CoV-2. Vaccines (Basel) 9

Back to the top

Specifications

pUNO1His-SARS2-S2

  • Strain: Wuhan-Hu-1 isolate
  • ORF size (S2::His): 1797 bp
  • Signal sequence: Native SARS-CoV-2
  • Codon-optimized 
  • Tag: C-terminal 6xHistidine
  • Subcloning restriction sites: AgeI (in 5’) and NheI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT

pUNO1Fc-SARS2-S2

  • Strain: Wuhan-Hu-1 isolate
  • ORF size (S2::hIgG1 Fc): 2544 bp
  • Signal sequence: Native SARS-CoV-2
  • Codon-optimized
  • Tag: C-terminal Human IgG1 Fc
  • Subcloning restriction sites: AgeI (in 5’) and MscI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - MscI generates blunt ends compatible with BaII, MIsI, MLuNI, Mox20I, and Msp20I restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Back to the top

Contents

pUNO1His-SARS2-S2 and pUNO1Fc-SARS2-S2 are provided as follows:

Please note: Each plasmid is sold separately. 

  • 20 μg of lyophilized DNA
  • 2 x 1 ml Blasticidin at 10 mg/ml

 

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

AlertAvoid repeated freeze-thaw cycles.

Back to the top

Details

Learn more about the SARS-CoV-2 Spike protein here.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty