Spike-expressing vectors for lentiviral pseudotyping

SARS-CoV-2 spike plasmid for pseudotyping lentiviral particles 

Production of SARS-CoV-2 spike (S)-pseudotyped lentiviral particles using InvivoGen's pLV-SARS2-S-d19 plasmid

pLV-SARS2-S-d19 and pLV-SARS2-S-d19 (D614G) plasmids have been designed for pseudotyping lentiviral particles with the SARS-CoV-2 Spike (S) protein. Pseudotyped particle production involves the co-transfection of 293T cells with a reporter protein vector (e.g. GFP), one or several plasmids encoding the necessary lentiviral proteins, and the pseudotyping pLV-SARS2-S-d19 plasmids. The transfected cells produce SARS‑CoV‑2 Spike (S)‑pseudotyped lentiviral particles, which can then be used to infect permissive cells, such as ACE2‑expressing HEK293-derived cells and ACE2‑TMPRSS2‑expressing A549-derived cells.

Interestingly, lentiviral particles expressing the globally dominant Spike G614‑variant have been shown to have greater infectivity of ACE2-expressing target cells, when compared to particles expressing the original D614 Spike protein [1,2]. Furthermore, there is evidence that Spike (D614 or G614)-pseudotyped particles trigger syncytia (i.e. cell fusion) in cells expressing hACE2 and TMPRSS2 [3, see figures]. 

Plasmid Description

pLV-SARS2-S-d19 and pLV-SARS2-S-d19 (D614G) plasmids encode the Spike (S) gene (codon‑optimized) from the original SARS-CoV-2 Wuhan‑Hu-1 (D614) isolate or the globally‑dominant G614-variant (D614G mutation), respectively [4]. Furthermore, to improve the expression of the S protein in pseudovirions and cell lines, the last 19 amino acids (d19), which contain the ER‑retention motif, have been removed [2, 5].

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human-(h)CMV composite promoter, a rabbit β-globin intron directly upstream of the spike gene, and a rabbit β-globin polyadenylation (pAn) signal. The spike coding sequence includes the SARS-CoV-2 signal sequence and the S1/S2 furin cleavage site. These plasmids are selectable with ampicillin in E. coli.

Quality Control

• Fully sequenced ORF
• Predominant supercoiled conformation
• Generation of infectious SARS-CoV-2 Spike (D614 or G614)-pseudotyped lentiviral particles using pLV-SARS2-S-d19 and pLV-SARS2-S-d19 (D614G), respectively, has been validated (see figures).

Gene Description

Spike (S) is a structural glycoprotein expressed on the surface of SARS‑CoV-2. It mediates membrane fusion and viral entry into target cells upon binding to the host receptor ACE2 and its cleavage by cellular proteases such as TMPRSS2 [6]. The S protein consists of an N-terminal ectodomain, a transmembrane anchor, and a short C‑terminal cytoplasmic tail. The ectodomain contains the S1 subunit, which encodes the receptor-binding domain (RBD), as well as the S2 subunit, needed for membrane fusion [7]. Notably, the C‑terminal cytoplasmic tail of the S protein encodes a presumptive endoplasmic reticulum (ER)‑retention motif (KxHxx), which has previously been shown to enable the accumulation of SARS‑CoV S proteins at the ER‑Golgi intermediate compartment (ERGIC) and facilitate their incorporation into new virions [8]. The removal of this motif (d19) has been shown to increase the expression of the spike protein in pseudovirions [2,5]. 

Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

References

1. Daniloski, Z. et al. 2020. The Spike D614G mutation increases SARS-CoV-2 infection of multiple human cell types. bioRxiv. doi:10.1101/2020.06.14.151357
2. Johnson, M.C. et al. 2020. Optimized pseudotyping conditions for the SARS-COV2 Spike glycoprotein. J Virol. 94(21):e01062-20
3. Buchrieser, J. et al. 2020. Syncytia formation by SARS-CoV-2 infected cells. EMBO J, e106267.
4. Korber B. et al. 2020. Tracking changes in SARS-CoV-2 Spike: evidence that D614G increases the infectivity of the COVID-19 virus. Cell. 182:1-16.
5. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
6. Hoffmann M. et al. 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
7. Walls A.C., et al. 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.
8. Ujike, M. et al. 2016. The contribution of the cytoplasmic retrieval signal of severe acute respiratory syndrome coronavirus to intracellular accumulation of S proteins and incorporation of S protein into virus-like particles. J Gen Virol 97, 1853-1864.
 

Figures

Infection of A549-derived cells by Spike (D614) pseudotyped lentiviral particles. ~1.0 x10⁴ A549-derived Null cells and A549-derived hACE2-TMPRSS2 cells were cultured in the presence of SARS-CoV-2 Spike (D614)-pseudotyped GFP lentiviral particles. The particles were generated using InvivoGen's pLV-SARS2-S-d19 plasmid. After 72 hr, the transduction efficiency of the Spike pseudotyped GFP particles was evaluated by fluorescence microscopy.

Infection of A549-derived cells by Spike (G614) pseudotyped lentiviral particles. ~1.0 x10⁴ A549-derived Null cells and A549-derived hACE2-TMPRSS2 cells were cultured in the presence of SARS-CoV-2 Spike (G614)-pseudotyped GFP lentiviral particles. The particles were generated using InvivoGen's pLV-SARS2-S-d19 (D614G) plasmid. After 72 hr, the transduction efficiency of the Spike pseudotyped GFP particles was evaluated by fluorescence microscopy. Syncytia are indicated with white arrows.

Specifications

pLV-SARS2-S-d19 (D614):

• Origin: Wuhan-Hu-1 isolate
• ORF size: Codon optimized 3765 bp 
• Sequencing primers:
  - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
  - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC

pLV-SARS2-S-d19 (D614G):

• Origin: pUNO1-SARS2-S with D614G mutation (original sequence)
• ORF size: Codon optimized 3765 bp
• Sequencing primers:
  - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
  - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC

Contents

pLV-SARS2-S-d19 (D614 or D614G) are provided as follows:

• 20 μg of lyophilized DNA

 The product is shipped at room temperature.

Lyophilized DNA should be stored at -20 °C.

Resuspended DNA should be stored at -20 °C and is stable up to 1 year.

Details

Learn more about the SARS-CoV-2 spike protein here.