Invivogen
Menu

Spike-expressing vectors for lentiviral pseudotyping

pLV-SARS2-S-d19 Unit size Cat. code Docs Qty Price
SARS-CoV-2 Spike gene (original D614) for lentiviral pseudotyping
20 µg
plv-cov2-sd19
+-
$397.00
pLV-SARS2-S-d19 (D614G) Unit size Cat. code Docs Qty Price
SARS-CoV-2 Spike gene (G614-variant) for lentiviral pseudotyping
20 µg
plv-cov2-sd19g
+-
$397.00

You may also need : Human ACE2 expressing HEK293 cells | View more associated products

SARS-CoV-2 spike plasmid for pseudotyping lentiviral particles 

SARS-CoV-2 spike (S)-pseudotyped lentiviral particle production
Production of SARS-CoV-2 spike (S)-pseudotyped lentiviral particles using InvivoGen's pLV-SARS2-S-d19 plasmid

pLV-SARS2-S-d19 and pLV-SARS2-S-d19 (D614G) plasmids have been designed for pseudotyping lentiviral particles with the SARS-CoV-2 Spike (S) protein. Pseudotyped particle production involves the co-transfection of 293T cells with a reporter protein vector (e.g. GFP), one or several plasmids encoding the necessary lentiviral proteins, and the pseudotyping pLV-SARS2-S-d19 plasmids. The transfected cells produce SARS‑CoV‑2 Spike (S)‑pseudotyped lentiviral particles, which can then be used to infect permissive cells, such as ACE2‑expressing HEK293-derived cells and ACE2‑TMPRSS2‑expressing A549-derived cells.

Interestingly, lentiviral particles expressing the globally dominant Spike G614‑variant have been shown to have greater infectivity of ACE2-expressing target cells, when compared to particles expressing the original D614 Spike protein [1,2]. Furthermore, there is evidence that Spike (D614 or G614)-pseudotyped particles trigger syncytia (i.e. cell fusion) in cells expressing hACE2 and TMPRSS2 [3, see figures]. 

 

Plasmid Description

pLV-SARS2-S-d19 and pLV-SARS2-S-d19 (D614G) plasmids encode the Spike (S) gene (codon‑optimized) from the original SARS-CoV-2 Wuhan‑Hu-1 (D614) isolate or the globally‑dominant G614-variant (D614G mutation), respectively [4]. Furthermore, to improve the expression of the S protein in pseudovirions and cell lines, the last 19 amino acids (d19), which contain the ER‑retention motif, have been removed [2, 5].

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human-(h)CMV composite promoter, a rabbit β-globin intron directly upstream of the spike gene, and a rabbit β-globin polyadenylation (pAn) signal. The spike coding sequence includes the SARS-CoV-2 signal sequence and the S1/S2 furin cleavage site. These plasmids are selectable with ampicillin in both E. coli and mammalian cells.

 

Quality Control

  • Fully sequenced ORF
  • Predominant supercoiled conformation
  • Generation of infectious SARS-CoV-2 Spike (D614 or G614)-pseudotyped lentiviral particles using pLV-SARS2-S-d19 and pLV-SARS2-S-d19 (D614G), respectively, has been validated (see figures).
 

Gene Description

Spike (S) is a structural glycoprotein expressed on the surface of SARS‑CoV-2. It mediates membrane fusion and viral entry into target cells upon binding to the host receptor ACE2 and its cleavage by cellular proteases such as TMPRSS2 [6]. The S protein consists of an N-terminal ectodomain, a transmembrane anchor, and a short C‑terminal cytoplasmic tail. The ectodomain contains the S1 subunit, which encodes the receptor-binding domain (RBD), as well as the S2 subunit, needed for membrane fusion [7]. Notably, the C‑terminal cytoplasmic tail of the S protein encodes a presumptive endoplasmic reticulum (ER)‑retention motif (KxHxx), which has previously been shown to enable the accumulation of SARS‑CoV S proteins at the ER‑Golgi intermediate compartment (ERGIC) and facilitate their incorporation into new virions [8]. The removal of this motif (d19) has been shown to increase the expression of the spike protein in pseudovirions [2,5]. 

 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Daniloski, Z. et al. 2020. The Spike D614G mutation increases SARS-CoV-2 infection of multiple human cell types. bioRxiv. doi:10.1101/2020.06.14.151357
2. Johnson, M.C. et al. 2020. Optimized pseudotyping conditions for the SARS-COV2 Spike glycoprotein. J Virol. 94(21):e01062-20
3. Buchrieser, J. et al. 2020. Syncytia formation by SARS-CoV-2 infected cells. EMBO J, e106267.
4. Korber B. et al. 2020. Tracking changes in SARS-CoV-2 Spike: evidence that D614G increases the infectivity of the COVID-19 virus. Cell. 182:1-16.
5. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
6. Hoffmann M. et al. 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
7. Walls A.C., et al. 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.
8. Ujike, M. et al. 2016. The contribution of the cytoplasmic retrieval signal of severe acute respiratory syndrome coronavirus to intracellular accumulation of S proteins and incorporation of S protein into virus-like particles. J Gen Virol 97, 1853-1864.
 

Figures

Infection of A549-derived cells by Spike (D614) pseudotyped lentiviral particles
Infection of A549-derived cells by Spike (D614) pseudotyped lentiviral particles

Infection of A549-derived cells by Spike (D614) pseudotyped lentiviral particles. ~1.0 x104 A549-derived Null cells and A549-derived hACE2-TMPRSS2 cells were cultured in the presence of SARS-CoV-2 Spike (D614)-pseudotyped GFP lentiviral particles. The particles were generated using InvivoGen's pLV-SARS2-S-d19 plasmid. After 72 hr, the transduction efficiency of the Spike pseudotyped GFP particles was evaluated by fluorescence microscopy.

Infection of A549-derived cells by Spike (G614) pseudotyped lentiviral particles.
Infection of A549-derived cells by Spike (G614) pseudotyped lentiviral particles.

Infection of A549-derived cells by Spike (G614) pseudotyped lentiviral particles. ~1.0 x104 A549-derived Null cells and A549-derived hACE2-TMPRSS2 cells were cultured in the presence of SARS-CoV-2 Spike (G614)-pseudotyped GFP lentiviral particles. The particles were generated using InvivoGen's pLV-SARS2-S-d19 (D614G) plasmid. After 72 hr, the transduction efficiency of the Spike pseudotyped GFP particles was evaluated by fluorescence microscopy. Syncytia are indicated with white arrows.

Back to the top

Specifications

pLV-SARS2-S-d19 (D614):

  • Origin: Wuhan-Hu-1 isolate
  • ORF size: Codon optimized 3765 bp 
  • Sequencing primers:
    - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
    - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC

pLV-SARS2-S-d19 (D614G):

  • Origin: pUNO1-SARS2-S with D614G mutation (original sequence)
  • ORF size: Codon optimized 3765 bp
  • Sequencing primers:
    - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
    - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC
Back to the top

Contents

pLV-SARS2-S-d19 (D614 or D614G) are provided as follows:

  • 20 μg of lyophilized DNA

 

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable up to 1 year.

 

Back to the top

Details

Learn more about the SARS-CoV-2 spike protein here.

Back to the top
Customer Service
& Technical Support
Shopping cart is empty