Invivogen
Menu

Full Spike (S) Expression Vector

pUNO1-SARS2-S Unit size Cat. code Docs Qty Price
SARS-CoV-2 full Spike wild-type gene
20 µg
puno1-cov2-s
+-
$397.00

SARS-CoV-2 Spike coding sequence

GENE DESCRIPTION

Spike (S) is a large type I transmembrane fusion protein expressed at the surface of coronaviruses. SARS-CoV-2 (2019-nCoV) Spike mediates the viral entry into the target cell upon binding to the ACE2 receptor [1, 2]. The Spike glycoprotein exhibits a large ectodomain comprised of two subunits. The S1 subunit contains the ACE2 receptor-binding domain (RBD), while the S2 subunit features the elements mediating the fusion of viral and host membranes [1, 2].
pUNO1-SARS2-S contains the wild-type coding sequence of SARS-CoV-2 Spike which includes its signal sequence and the endoplasmic reticulum-retention signal sequence (See Details and Specifications for more information).

 

Schematic of SARS-CoV-2 Spike expression vector
Schematic of SARS-CoV-2 Spike expression vector

PLASMID DESCRIPTION

pUNO1-SARS2-S features a potent mammalian expression cassette comprised of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal. The ORF is flanked by unique restriction sites (AgeI and NheI) to facilitate its subcloning. The plasmid is selectable with blasticidin in both E. coli and mammalian cells. It can be used for transient or stable transfection. It contains no tag.
 

QUALITY CONTROL

  • Fully sequenced ORF
  • Predominant supercoiled conformation

 

For the production of tagged Spike ectodomain, choose pUNO1His-SARS2-S or pUNO1Fc-SARS2-S, for Spike::His-tag or Spike::Fc-tag, respectively.

 

Learn more on SARS-CoV-2Learn more about SARS-CoV-2 infection cycle, immune responses, and potential therapeutics.

 

References

1. Hoffmann M. et al., 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
2. Walls A.C., et al., 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.

Figures

Schematic of pUNO1-SARS2-S expression vector
Schematic of pUNO1-SARS2-S expression vector
SARS-CoV-2 structural proteins
SARS-CoV-2 structural proteins
SARS-CoV-2 Spike protein
SARS-CoV-2 Spike protein
Back to the top

Specifications

  • Strain: Wuhan-Hu-1 isolate (D614)
  • Genbank: NC_045512.2
  • ORF size from ATG to Stop codon: 3822 bp
  • Native (wild-type) sequence
  • Subcloning restriction sites in pUNO1: AgeI (in 5’) and NheI (in 3’)
    - AgeI generates cohesive ends compatible with XmaI, BspEI, NgoMIV, and SgrAI restriction sites
    - NheI generates cohesive ends compatible with AvrII, SpeI, and XbaI restriction sites
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
Back to the top

Contents

  • 20 μg of lyophilized DNA
  • 2 x 1 ml blasticidin at 10 mg/ml

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 ̊C.

stability Resuspended DNA should be stored at -20 ̊C and is stable up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions.

Store blasticidin at 4°C or -20°C for up to two years. The product is stable for 2 weeks at 37°C.

Avoid repeated freeze-thaw cycles.

Back to the top

Details

SARS-CoV and SARS-CoV-2 coronaviruses share strong similarities. Thus, most of our current knowledge about the SARS-CoV-2 Spike is based on analogies with findings on the SARS-CoV Spike. The spike glycoprotein contains three segments: a large ectodomain, a transmembrane anchor (TM), and a short intracellular tail (IC) [1-3]. The ectodomain consists of two subunits:

  • S1 binds to the ACE2 receptor on host target cells. S1 contains an N-terminal (S1-NTD) and a C-terminal (S1-CTD) subdomains. The S1-CTD contains the receptor-binding domain (RBD) for the ACE2 receptor at the surface of target cells.
     
  • S2 mediates the fusion of viral and host membranes. The fusion is operating through the action of a fusion peptide (FP) and two heptad repeats (HR1 and HR2).

Two cleavage sites at the S1 and S2 boundary (S1/S2) and in the S2 domain (S2’) play an essential role in the viral entry into host target cells [3, 4].

Spike is assembled as a trimer of three protomers, and the protein exists in two structurally distinct conformations: pre-fusion and post-fusion.
In its pre-fusion state, the Spike is a clove-shaped trimer with three S1 heads and a trimeric S2 stalk, and RBDs are buried at the interface between each protomer [2]. The opening of the S1-CTD is thus expected to be necessary for binding to ACE2. SARS-CoV-2 exhibits a furin cleavage site at the S1/S2 boundary, which may be responsible for a pre-fusion conformation where the S1-NTD structurally constrains the S2 domain [3]. The exact mechanisms driving the opening of an S1-CTD domain and exposition of RBD so that it can bind the ACE2 receptor are not elucidated yet.
It has been proposed that the S protein is cleaved into S1 and S2 subunits by proteases, including furin and TMPRSS2 [3, 4]. S1 binds to ACE2 through RBD, and S2 is further cleaved and activated by the host surface-associated transmembrane protease serine 2 (TMPRSS2) [3, 4]. Together these actions result in host-viral membrane fusion and the viral RNA genome is released into the host cell cytoplasm.

The previous SARS-CoV and MERS-CoV outbreaks have prompted the search for protective vaccines. Among the different strategies, protein vaccination using the full Spike or its S1 or RBD fragments, have provided encouraging results in pre-clinical studies [5], and some have reached a clinical-stage (phase I) [6]. One clinical trial testing a prophylactic SARS-CoV-2 vaccine based on the full-length Spike mRNA has been launched in March 2020 [NCT04283461].

 

References

1. Li F., 2016. Structure, function, and evolution of coronavirus spike proteins. Annu. Rev. Virol. 3:237-261.
2. Li F. et al., 2005. Structure of SARS coronavirus spike receptor-binding domain complexed with receptor. Science. 309:1864-1868.
3. Walls A.C. et al., 2020. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 181(2):281-292.e6.
4. Hoffmann M. et al., 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 181:1-16.
5. Wang N. et al., 2020. Subunit vaccines against emerging pathogenic human coronaviruses. Front. Microbiol. 11:298. DOI: 10.3389/fmicb.2020.00298.
6. Padron-Regalado E., 2020. Vaccines for SARS-CoV-2: Lessons from other coronavirus strains. Infect. Dis. Ther. DOI: 10.1007/s40121-020-00300-x.

 

Back to the top
Customer Service
& Technical Support
Shopping cart is empty